Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS27P31
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:109030030-109030376  UCSC
Coordinates (T2T) chr1:109063399-109063745  UCSC
Coordinates (hg19) chr1:109572652-109572998  UCSC
Strand +
Parental Sequence NM_001030.6
Parental seq. overlap 299 bp
Parental seq. overlap (%) 84.7%
Genomic Region Intragenic (WDR47)
Retrocopy Summary RPS27P31, located on chr1:109030030-109030376, is a retrocopy of the parental gene RPS27. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS27
Full Name ribosomal protein S27
Also known as DBA17|MPS-1|MPS1|S27
Coordinate chr1:153990762-153992155
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the S27e family of ribosomal proteins and component of the 40S subunit. The encoded protein contains a C4-type zinc finger domain that can bind to zinc and may bind to nucleic acid. Mutations in this gene have been identified in numerous melanoma patients and in at least one patient with Diamond-Blackfan anemia (DBA). Elevated expression of this gene has been observed in various human cancers. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2018]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS27P1
Bonobo Pan paniscus RPS27P1
Gorilla Gorilla gorilla RPS27P1
Orangutan Pongo abelii RPS27P1
Gibbon Nomascus leucogenys RPS27P21
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS27P31
CCCTTTCTGGCAGTGACGACCTACCCACAGGAGAACATGCCTCTCGCAAAAGATCTCCTTCATCCCTCCCCACGCCTGGTGCAGAGCCCCAATTCCTACTTCATGGGTGTGAAATGCCCAGGATAATATAAATCACCACGGTCTTTAGCCATGCACAAATGGTAGTTTTGTGTGTTGGCTGCTCCACTGTCCTCTGCCAGCCTACAGGAGGAAAAGCAAGGCTTACAGAAGGATGTTCCTTCAGGAAGAAGCAGCACTAAAAGCACTCTGAATCAAGATGAGTGGGAAACCATCTCAATAAGCACATTTTTGAT
>NM_001030.6
CCTTTCCGGCGGTGACGACCTACGCACACGAGAACATGCCTCTCGCAAAGGATCTCCTTCATCCCTCTCCAGAAGAGGAGAAGAGGAAACACAAGAAGAAACGCCTGGTGCAGAGCCCCAATTCCTACTTCATGGATGTGAAATGCCCAGGATGCTATAAAATCACCACGGTCTTTAGCCATGCACAAACGGTAGTTTTGTGTGTTGGCTGCTCCACTGTCCTCTGCCAGCCTACAGGAGGAAAAGCAAGGCTTACAGAAGGATGTTCCTTCAGGAGGAAGCAGCACTAAAAGCACTCTGAGTCAAGATGAGTGGGAAACCATCTCAATAAACACATTTTGGATAAATCCTG

Publications

PMID - Link Title