Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name TOMM6P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr11) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr11:130544364-130544766  UCSC
Coordinates (T2T) chr11:130580088-130580490  UCSC
Coordinates (hg19) chr11:130414259-130414661  UCSC
Strand -
Parental Sequence NM_001382294.1
Parental seq. overlap 343 bp
Parental seq. overlap (%) 60.5%
Genomic Region Intergenic
Retrocopy Summary TOMM6P1, located on chr11:130544364-130544766, is a retrocopy of the parental gene TOMM6. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name TOMM6
Full Name translocase of outer mitochondrial membrane 6
Also known as OBTP|TOM6
Coordinate chr6:41787694-41789895
Strand +
Gene summary Predicted to be involved in protein transport. Located in mitochondrion. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes TOMM6P1
Bonobo Pan paniscus TOMM6P1
Gorilla Gorilla gorilla PRICKLE4P1
Orangutan Pongo abelii TOMM6P1
Gibbon Nomascus leucogenys PRICKLE4P3
Green monkey Chlorocebus sabaeus TOMM6P1
Crab-eating macaque Macaca fascicularis PRICKLE4P6
Rhesus Macaca mulatta TOMM6P7
Baboon Papio anubis PRICKLE4P4
Golden snub-nosed monkey Rhinopithecus roxellana PRICKLE4P7
Marmoset Callithrix jacchus TOMM6P8
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Related Sequence

>TOMM6P1
GCTTTGCCACTGATAGGAATGATTTCCAGAGATACTTAATCCTCAATTCGGGACTCTTTGCTTCAGGAGTTTGGCTGGCCAGGAACATGAGTGACAGTGACCTCTTGGCACTTCAGCTGGGGGTGTAGCCAAGCAGACAAATGGAATCTTGTGCTGAACCCAAACCTTCTAGAAACAGAGCCTGTGAGCATCACAAGATATGCCCTGATGGAAGCTGAAGTTTAATTCAGCTGAGCGCTTGCCCCTTTCCAACCTGGTTTCTTTTTGTTCCTTGAGTCCAGTCAGAATGCCATTCCCTGGCCAGCAGCCAGCCTTTAGTGACTGTCTCTGTTCTGCAAAGCTCTGTATATAGTTACTGAGTTTCTGCAGGGGGTGATCTTTGCTCTTGTCCTAAGAAATAACT
>NM_001382294.1
CACTATGGCTTCCAGCACTGTCCCGGTGAGCGCTGCTGGCTCGGCTAATGAAACTCCCGAAATACCGGACAACGTGGGAGATTGGCTTCGGGGCGTCTACCGCTTTGCCACTGATAGGAATGACTTCCGGAGGAACTTGATACTAAATTTGGGACTCTTTGCTGCGGGAGTTTGGCTGGCCAGGAACTTGAGTGACATTGACCTCATGGCACCTCAGCCAGGGGTGTAGCCAAGTAGACAAATGGAATCCTGTGCTGAACCCGAATCTTCCAAAAAACAGCCTACAATCTGTGACCACCACAAGATGTGCCCTGATGGCAGCTGAAGTTTGATTCAGATGGGCACTTTTCTTCCCCTTCCCTGCCTAGTTTCCTTTTGTTCCTTGAGTCCAcgcagaattccattctctggtcagcagacaggcttaagctaaagtattgcctctattctgtaaagttctGTACATAGTTCCCAAGCTTCTGCAGGGGGTGATTTTTGCTCTTGTCCTGAGAAATAACAGTGCTGTTTTAAAAAACATTTGAAATAAATACCGCACACAAAGGCA

Publications

PMID - Link Title
No publications available for this retrocopy