Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL29P23
Plot displaying the genomic locations of a retrocopy (in chr11) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr11:33190159-33190533  UCSC
Coordinates (T2T) chr11:33325685-33326059  UCSC
Coordinates (hg19) chr11:33211705-33212079  UCSC
Strand -
Parental Sequence NM_000992.3
Parental seq. overlap 320 bp
Parental seq. overlap (%) 42.3%
Genomic Region Intergenic
Retrocopy Summary RPL29P23, located on chr11:33190159-33190533, is a retrocopy of the parental gene RPL29. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL29
Full Name ribosomal protein L29
Also known as HIP|HUMRPL29|L29|RPL29P10|RPL29_3_370
Coordinate chr3:51993522-51995895
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29E family of ribosomal proteins. The protein is also a peripheral membrane protein expressed on the cell surface that directly binds heparin. Although this gene was previously reported to map to 3q29-qter, it is believed that it is located at 3p21.3-p21.2. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL29P23
Bonobo Pan paniscus RPL29P22
Gorilla Gorilla gorilla RPL29P18
Orangutan Pongo abelii RPL29P20
Gibbon Nomascus leucogenys RPL29P21
Green monkey Chlorocebus sabaeus RPL29P1
Crab-eating macaque Macaca fascicularis RPL29P27
Rhesus Macaca mulatta RPL29P27
Baboon Papio anubis RPL29P25
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL29P23
GCTTCTGGAGCCACAGGTTATGATGTAGACATGGCCAAGTCCAAGAACCACACCACACACAACCAGTCCCAAAAATGGTACAGAAATGACATCAAGAAACTGTGATAACAAAGATACAAACCTCTTAATGGGGTAGACCCCAAGTTCCTGAGGAACATGTGCTTTGCCAAGAAGCACAACAAGAAGGGCGTGAATAAGAAGCGGGCCAACAGTACCAATGCCATGTGTCTGTATGCCAAGTCTATCAAAGTCCTCAAAAAGGCCAAGGAGGTTAAGTCCCAAATCCCAAAGCACATCATCCAGAAGCTCAATTGACTTGCCTACATTGCCTACCCCAAGCTCGGGAAGCGTGCTCCTGCCTGCATTGCCAAGGGT
>NM_000992.3
CTCTTCCGGTTCTAGGCGCTTCGGGAGCCGCGGCTTATGGTGCAGACATGGCCAAGTCCAAGAACCACACCACACACAACCAGTCCCGAAAATGGCACAGAAATGGTATCAAGAAACCCCGATCACAAAGATACGAATCTCTTAAGGGGGTGGACCCCAAGTTCCTGAGGAACATGCGCTTTGCCAAGAAGCACAACAAAAAGGGCCTAAAGAAGATGCAGGCCAACAATGCCAAGGCCATGAGTGCACGTGCCGAGGCTATCAAGGCCCTCGTAAAGCCCAAGGAGGTTAAGCCCAAGATCCCAAAGGGTGTCAGCCGCAAGCTCGATCGACTTGCCTACATTGCCCACCCCAAGCTTGGGAAGCGTGCTCGTGCCCGTATTGCCAAGGggctcaggctgtgccggccaaaggccaaggccaaggccaaggccaaggatcaaaccaaggcccaggctgcagccccagcttcagttccagctcaggctcCCAAACGTACCCAGGCCCCTACAAAGGCTTCAGAGTAGATATCTCTGCCAACATGAGGACAGAAGGACTGGTGCGACCCCCCACCCCCGCCCCTGGGCTACCATCTGCATGGGGCTGGGGTCCTCCTGTGCTATTTGTACAAATAAACCTGAGGCAGGATTTGTTAGCCTCTGTCTATGATCCTGGGGATGGGTTTGGTTGCTCCATCTGTTGGTGTGGGAGAAGACATGGGTCTGGATGGTGGGGTGTGGGTGGGAGTCAGGAG

Publications

PMID - Link Title