Retrocopy Name | COX5BP8 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr1:179255816-179256017 UCSC | |
Coordinates (T2T) | chr1:178610812-178611013 UCSC | |
Coordinates (hg19) | chr1:179224951-179225152 UCSC | |
Strand | + | |
Parental Sequence | NM_001862.3 | |
Parental seq. overlap | 175 bp | |
Parental seq. overlap (%) | 25.4% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | COX5BP8, located on chr1:179255816-179256017, is a retrocopy of the parental gene COX5B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | COX5B |
Full Name | cytochrome c oxidase subunit 5B |
Also known as | COXVB |
Coordinate | chr2:97646062-97648383 |
Strand | + |
Gene summary | Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | COX5BP1 |
![]() |
Bonobo | Pan paniscus | LOC100972878P1 |
![]() |
Gorilla | Gorilla gorilla | LOC101138406P1 |
![]() |
Gibbon | Nomascus leucogenys | LOC100595152P6 |
![]() |
Green monkey | Chlorocebus sabaeus | LOC103241089P7 |
![]() |
Crab-eating macaque | Macaca fascicularis | LOC102132790P1 |
![]() |
Rhesus | Macaca mulatta | LOC707227P1 |
![]() |
Baboon | Papio anubis | LOC101007148P1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104661470P3 |
![]() |
Marmoset | Callithrix jacchus | LOC100412088P7 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>COX5BP8 |
ACTCCATGGCATCTGGAGGTGGTGTTCTTACTGATGACAAGAAGGCGGCTGGGTTGGAGAGGGAGCTCATGATGGCTGCACGGAAGGGACTGGACCCATACAGTATAATACCCCCAAAGGCAGCTTCAGTCACAGGGAACCCTAATTTGGTCCCCACCATCACCAATAAGTGAATAGTGGGCTATATCTATGAAGAGGACAA |
>NM_001862.3 |
AGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGGCCCTGAGGGCTCGCGGCCCCAGTGGCGCGGCCGCGATGCGCTCCATGGCATCTGGAGGTGGTGTTCCCACTGATGAAGAGCAGGCGACTGGGTTGGAGAGGGAGATCATGCTGGCTGCAAAGAAGGGACTGGACCCATACAATGTACTGGCCCCAAAGGGAGCTTCAGGCACCAGGGAAGACCCTAATTTAGTCCCCTCCATCTCCAACAAGAGAATAGTAGGCTGCATCTGTGAAGAGGACAATACCAGCGTCGTCTGGTTTTGGCTGCACAAAGGCGAGGCCCAGCGATGCCCCCGCTGTGGAGCCCATTACAAGCTGGTGCCCCAGCAGCTGGCACACTGAGCACCTGCACTAAATTACTCAAAATGTGCTGTAAAGTTTCTTCTTTCCAGTAAAGACTAGCCATTGCATTGGCTCCTTCTCCCATAGATGGCTGGTCTTATTTCTTACCCGTATTCTTTGGTAGGCATGGAATATGCTTATTTTGGGAAAAGCTGTCTGTTAATGCTAGCTTGCCATCCACTTACTGAAAGTGTATAACCAGTGTATAGTGCTTAGATTAATAATAAGAATAGATCGACAACCCGTAATGCAATGAATgggaccacctggtatga |
PMID - Link | Title |
---|