| Retrocopy Name | COX5BP8 | 
                 | 
        
| Species | Homo sapiens | |
| Coordinates (hg38) | chr1:179255816-179256017 UCSC | |
| Coordinates (T2T) | chr1:178610812-178611013 UCSC | |
| Coordinates (hg19) | chr1:179224951-179225152 UCSC | |
| Strand | + | |
| Parental Sequence | NM_001862.3 | |
| Parental seq. overlap | 175 bp | |
| Parental seq. overlap (%) | 25.4% | |
| Genomic Region | 
									Intergenic | 
        |
| Retrocopy Summary | COX5BP8, located on chr1:179255816-179256017, is a retrocopy of the parental gene COX5B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | COX5B | 
| Full Name | cytochrome c oxidase subunit 5B | 
| Also known as | COXVB | 
| Coordinate | chr2:97646062-97648383 | 
| Strand | + | 
| Gene summary | Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008] | 
| Species | Scientific Name | Retrocopy | |
![]()  | 
			Chimpanzee | Pan troglodytes | COX5BP1 | 
![]()  | 
			Bonobo | Pan paniscus | LOC100972878P1 | 
![]()  | 
			Gorilla | Gorilla gorilla | LOC101138406P1 | 
![]()  | 
			Gibbon | Nomascus leucogenys | LOC100595152P6 | 
![]()  | 
			Green monkey | Chlorocebus sabaeus | LOC103241089P7 | 
![]()  | 
			Crab-eating macaque | Macaca fascicularis | LOC102132790P1 | 
![]()  | 
			Rhesus | Macaca mulatta | LOC707227P1 | 
![]()  | 
			Baboon | Papio anubis | LOC101007148P1 | 
![]()  | 
			Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104661470P3 | 
![]()  | 
			Marmoset | Callithrix jacchus | LOC100412088P7 | 
![]()  | 
			Orangutan | Pongo abelii | Without Homology | 
![]()  | 
			Mouse lemur | Microcebus murinus | Without Homology | 
![]()  | 
			Mouse | Mus musculus | Without Homology | 
![]()  | 
			Rat | Rattus norvegicus | Without Homology | 
![]()  | 
			Chinese hamster | Cricetulus griseus | Without Homology | 
![]()  | 
			Rabbit | Oryctolagus cuniculus | Without Homology | 
![]()  | 
			Pig | Sus scrofa | Without Homology | 
![]()  | 
			Cow | Bos taurus | Without Homology | 
![]()  | 
			Sheep | Ovis aries | Without Homology | 
![]()  | 
			Dolphin | Tursiops truncatus | Without Homology | 
![]()  | 
			Horse | Equus caballus | Without Homology | 
![]()  | 
			Dog | Canis familiaris | Without Homology | 
![]()  | 
			Panda | Ailuropoda melanoleuca | Without Homology | 
![]()  | 
			Cat | Felis catus | Without Homology | 
![]()  | 
			Pale spear-nosed bat | Phyllostomus discolor | Without Homology | 
![]()  | 
			Velvety free-tailed bat | Molossus molossus | Without Homology | 
![]()  | 
			Greater mouse-eared bat | Myotis myotis | Without Homology | 
![]()  | 
			Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology | 
![]()  | 
			Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
![]()  | 
			Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
![]()  | 
			Sloth | Choloepus didactylus | Without Homology | 
![]()  | 
			Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
![]()  | 
			Opossum | Monodelphis domestica | Without Homology | 
![]()  | 
			Platypus | Ornithorhynchus anatinus | Without Homology | 
![]()  | 
			Chicken | Gallus gallus | Without Homology | 
![]()  | 
			Turkey | Meleagris gallopavo | Without Homology | 
![]()  | 
			Zebra Finch | Taeniopygia guttata | Without Homology | 
![]()  | 
			Budgerigar | Melopsittacus undulatus | Without Homology | 
![]()  | 
			Painted Turtle | Chrysemys picta | Without Homology | 
![]()  | 
			Lizard | Anolis Carolinensis | Without Homology | 
![]()  | 
			Frog | Xenopus tropicalis | Without Homology | 
![]()  | 
			Zebrafish | Danio rerio | Without Homology | 
![]()  | 
			Drosophila | Drosophila melanogaster | Without Homology | 
| >COX5BP8 | 
| ACTCCATGGCATCTGGAGGTGGTGTTCTTACTGATGACAAGAAGGCGGCTGGGTTGGAGAGGGAGCTCATGATGGCTGCACGGAAGGGACTGGACCCATACAGTATAATACCCCCAAAGGCAGCTTCAGTCACAGGGAACCCTAATTTGGTCCCCACCATCACCAATAAGTGAATAGTGGGCTATATCTATGAAGAGGACAA | 
| >NM_001862.3 | 
| AGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGGCCCTGAGGGCTCGCGGCCCCAGTGGCGCGGCCGCGATGCGCTCCATGGCATCTGGAGGTGGTGTTCCCACTGATGAAGAGCAGGCGACTGGGTTGGAGAGGGAGATCATGCTGGCTGCAAAGAAGGGACTGGACCCATACAATGTACTGGCCCCAAAGGGAGCTTCAGGCACCAGGGAAGACCCTAATTTAGTCCCCTCCATCTCCAACAAGAGAATAGTAGGCTGCATCTGTGAAGAGGACAATACCAGCGTCGTCTGGTTTTGGCTGCACAAAGGCGAGGCCCAGCGATGCCCCCGCTGTGGAGCCCATTACAAGCTGGTGCCCCAGCAGCTGGCACACTGAGCACCTGCACTAAATTACTCAAAATGTGCTGTAAAGTTTCTTCTTTCCAGTAAAGACTAGCCATTGCATTGGCTCCTTCTCCCATAGATGGCTGGTCTTATTTCTTACCCGTATTCTTTGGTAGGCATGGAATATGCTTATTTTGGGAAAAGCTGTCTGTTAATGCTAGCTTGCCATCCACTTACTGAAAGTGTATAACCAGTGTATAGTGCTTAGATTAATAATAAGAATAGATCGACAACCCGTAATGCAATGAATgggaccacctggtatga | 
| PMID - Link | Title | 
|---|