Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name COX5BP8
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:179255816-179256017  UCSC
Coordinates (T2T) chr1:178610812-178611013  UCSC
Coordinates (hg19) chr1:179224951-179225152  UCSC
Strand +
Parental Sequence NM_001862.3
Parental seq. overlap 175 bp
Parental seq. overlap (%) 25.4%
Genomic Region Intergenic
Retrocopy Summary COX5BP8, located on chr1:179255816-179256017, is a retrocopy of the parental gene COX5B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX5B
Full Name cytochrome c oxidase subunit 5B
Also known as COXVB
Coordinate chr2:97646062-97648383
Strand +
Gene summary Cytochrome C oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit Vb of the human mitochondrial respiratory chain enzyme. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX5BP1
Bonobo Pan paniscus LOC100972878P1
Gorilla Gorilla gorilla LOC101138406P1
Gibbon Nomascus leucogenys LOC100595152P6
Green monkey Chlorocebus sabaeus LOC103241089P7
Crab-eating macaque Macaca fascicularis LOC102132790P1
Rhesus Macaca mulatta LOC707227P1
Baboon Papio anubis LOC101007148P1
Golden snub-nosed monkey Rhinopithecus roxellana LOC104661470P3
Marmoset Callithrix jacchus LOC100412088P7
Orangutan Pongo abelii Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>COX5BP8
ACTCCATGGCATCTGGAGGTGGTGTTCTTACTGATGACAAGAAGGCGGCTGGGTTGGAGAGGGAGCTCATGATGGCTGCACGGAAGGGACTGGACCCATACAGTATAATACCCCCAAAGGCAGCTTCAGTCACAGGGAACCCTAATTTGGTCCCCACCATCACCAATAAGTGAATAGTGGGCTATATCTATGAAGAGGACAA
>NM_001862.3
AGTTTTGCTGCTAGTCGCGGACGCAATGGCTTCAAGGTTACTTCGCGGAGCTGGAACGCTGGCCGCGCAGGCCCTGAGGGCTCGCGGCCCCAGTGGCGCGGCCGCGATGCGCTCCATGGCATCTGGAGGTGGTGTTCCCACTGATGAAGAGCAGGCGACTGGGTTGGAGAGGGAGATCATGCTGGCTGCAAAGAAGGGACTGGACCCATACAATGTACTGGCCCCAAAGGGAGCTTCAGGCACCAGGGAAGACCCTAATTTAGTCCCCTCCATCTCCAACAAGAGAATAGTAGGCTGCATCTGTGAAGAGGACAATACCAGCGTCGTCTGGTTTTGGCTGCACAAAGGCGAGGCCCAGCGATGCCCCCGCTGTGGAGCCCATTACAAGCTGGTGCCCCAGCAGCTGGCACACTGAGCACCTGCACTAAATTACTCAAAATGTGCTGTAAAGTTTCTTCTTTCCAGTAAAGACTAGCCATTGCATTGGCTCCTTCTCCCATAGATGGCTGGTCTTATTTCTTACCCGTATTCTTTGGTAGGCATGGAATATGCTTATTTTGGGAAAAGCTGTCTGTTAATGCTAGCTTGCCATCCACTTACTGAAAGTGTATAACCAGTGTATAGTGCTTAGATTAATAATAAGAATAGATCGACAACCCGTAATGCAATGAATgggaccacctggtatga

Publications

PMID - Link Title