Retrocopy Name | DYNLL1P3 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr1:18513007-18513395 UCSC | |
Coordinates (T2T) | chr1:18333063-18333451 UCSC | |
Coordinates (hg19) | chr1:18839501-18839889 UCSC | |
Strand | + | |
Parental Sequence | NM_003746.3 | |
Parental seq. overlap | 351 bp | |
Parental seq. overlap (%) | 52.9% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | DYNLL1P3, located on chr1:18513007-18513395, is a retrocopy of the parental gene DYNLL1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | DYNLL1 |
Full Name | dynein light chain LC8-type 1 |
Also known as | DLC1|DLC8|DNCL1|DNCLC1|LC8|LC8a|PIN|hdlc1 |
Coordinate | chr12:120469842-120498493 |
Strand | + |
Gene summary | Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | DYNLL1P1 |
![]() |
Bonobo | Pan paniscus | DYNLL1P1 |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>DYNLL1P3 |
TAGATGTGCCACAGCTTCAGTAGCGACAGCAGCTCCAGCCCCGCCTGAGCAATGCTAGCACCTCCCCCAGGAGACTGTTGCCGTCGGCCAGCCCCCTTCTCCACGGTAACCATGTGCCACCGAGAGACCATGATCAAAAATGCAGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTATTCAGGCACTGGAGAAATATAACATAGAGAAGGATATTGCAGCTCATCTTAAGAAGGAATTTGACAAGAAGAACAATCCCACCTGGCATTGTATCGTGGGGAGGAACTTCGGTAGTTACATGACACGTGAAATCAAACACTTCATCTACTTCTACCTGGACCAAGTGGCCATTCTCTTGTTCAAATCTGGTTAAAAGCAT |
>NM_003746.3 |
AGATGCGCCACGGTTTCGGTAGCGACGGTATCTCTAGCCGGGCCTGAGCTGTGCTAGCACCTCCCCCAGGAGACCGTTGCAGTCGGCCAGCCCCCTTCTCCACGGTAACCATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGACAAGAAGTACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACACATGAAACCAAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTTCAAATCTGGTTAAAAGCATGGACTGTGCCACACACCCAGTGATCCATCCAAAAACAAGGACTGCAGCCTAAATTCCAAATACCAGAGACTGAAATTTTCAGCCTTGCTAAGGGAACATCTCGATGTTTGAACCTTTGTTGTGTTTTGTACAGGGCATTCTCTGTACTAGTTTGTCGTGGTTATAAAACAATTAGCAGAATAGCCTACATTTGTATTTATTTTCTATTCCATACTTCTGCCCACGTTGTTTTCTCTCAAAATCCATTCCTTTAAAAAATAAATCTGATGCAGATGTG |
PMID - Link | Title |
---|