Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFB11P1
Plot displaying the genomic locations of a retrocopy (in chr11) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr11:92335968-92336519  UCSC
Coordinates (T2T) chr11:92262705-92263256  UCSC
Coordinates (hg19) chr11:92069134-92069685  UCSC
Strand -
Parental Sequence NM_001135998.3
Parental seq. overlap 485 bp
Parental seq. overlap (%) 82.3%
Genomic Region Intragenic (FAT3)
Retrocopy Summary NDUFB11P1, located on chr11:92335968-92336519, is a retrocopy of the parental gene NDUFB11. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFB11
Full Name NADH:ubiquinone oxidoreductase subunit B11
Also known as CI-ESSS|ESSS|MC1DN30|NP17.3|Np15|P17.3
Coordinate chrX:47142216-47145491
Strand -
Gene summary The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is located at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to ubiquinone. Mutations in the human gene are associated with linear skin defects with multiple congenital anomalies 3 and mitochondrial complex I deficiency. [provided by RefSeq, Dec 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFB11P1
Bonobo Pan paniscus NDUFB11P1
Gorilla Gorilla gorilla NDUFB11P1
Orangutan Pongo abelii NDUFB11P1
Gibbon Nomascus leucogenys NDUFB11P1
Green monkey Chlorocebus sabaeus NDUFB11P1
Crab-eating macaque Macaca fascicularis NDUFB11P2
Rhesus Macaca mulatta NDUFB11P2
Baboon Papio anubis NDUFB11P1
Golden snub-nosed monkey Rhinopithecus roxellana NDUFB11P1
Marmoset Callithrix jacchus NDUFB11P2
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFB11P1
GAGACCCTGTAGGACTATCTGTCATGGCAGTTGGGCTGTTAAGTTTGAGCGCTCCCAGTCTTTTGGCGGCAGTGGTGATGCAAAGGCTCTTGGCCACCCACCTCCGCTGGGAATCCAGCTTCTCCAGGACTGTGGTCGCCCTGTCTGCTGTGGTGGGAAAACAGCCCCCGGAACTGACCGTACATTGGCAGGAGGACCCAGATCCTGAGGACAAAAACTTCTATGAGAAGAACCCAGACTCCCATTGCTATGACAAGGACCCCATTTTGGACATCTGGAACATGTGAGTTGTCTTCTTCTTTGGCGTCTCCATTGTCCCGGTCCTTGGCAGCACCTTTGTGGCCTATCTGCCTGATTACAGGATGCGAGAGTGGGCCCACTGCAGAGCTGAGATGCTTGTGAAATACCGAGAGGCCAAAGACCTTCCCATCATGGAATCCAACTGCTTCAACCCCAGCACGATCCAGTTGCCAGAGGATGAGAACTGACCAGTTGCTGAGTGGAGCTCAAGAAGCACCACCTTCCCCACCCCTTGCCTGCCATTCTGACCTA
>NM_001135998.3
GAGACCCTGCAGCACCATCTGTCATGGCGGCTGGGCTGTTTGGTTTGAGCGCTCGCCGTCTTTTGGCGGCAGCGGCGACGCGAGGGCTCCCGGCCGCCCGCGTCCGCTGGGAATCTAGCTTCTCCAGGACTGTGGTCGCCCCGTCCGCTGTGGCGGGAAAGCGGCCCCCAGAACCGACCACACCGTGGCAAGAGGACCCAGAACCCGAGGACGAAAACTTGTATGAGAAGAACCCAGACTCCCATGGTTATGACAAGGACCCCGTTTTGGACGTCTGGAACATGCGACTTGTCTTCTTCTTTGGCGTCTCCATCATCCTGGTCCTTGGCAGCACCTTTGTGGCCTATCTGCCTGACTACAGGATGAAAGAGTGGTCCCGCCGCGAAGCTGAGAGGCTTGTGAAATACCGAGAGGCCAATGGCCTTCCCATCATGGAATCCAACTGCTTCGACCCCAGCAAGATCCAGCTGCCAGAGGATGAGTGACCAGTTGCTAAGTGGGGCTCAAGAAGCACCGCCTTCCCCACCCCCTGCCTGCCATTCTGACCTCTTCTCAGAGCACCTAATTAAAGGGGCTGAAAGTCTGA

Publications

PMID - Link Title