Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name DYNLL1P4
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr12). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:113789445-113789817  UCSC
Coordinates (T2T) chr12:113765282-113765654  UCSC
Coordinates (hg19) chr12:114227250-114227622  UCSC
Strand -
Parental Sequence NM_001037495.2
Parental seq. overlap 334 bp
Parental seq. overlap (%) 49.3%
Genomic Region Intergenic
Retrocopy Summary DYNLL1P4, located on chr12:113789445-113789817, is a retrocopy of the parental gene DYNLL1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DYNLL1
Full Name dynein light chain LC8-type 1
Also known as DLC1|DLC8|DNCL1|DNCLC1|LC8|LC8a|PIN|hdlc1
Coordinate chr12:120469842-120498493
Strand +
Gene summary Cytoplasmic dyneins are large enzyme complexes with a molecular mass of about 1,200 kD. They contain two force-producing heads formed primarily from dynein heavy chains, and stalks linking the heads to a basal domain, which contains a varying number of accessory intermediate chains. The complex is involved in intracellular transport and motility. The protein described in this record is a light chain and exists as part of this complex but also physically interacts with and inhibits the activity of neuronal nitric oxide synthase. Binding of this protein destabilizes the neuronal nitric oxide synthase dimer, a conformation necessary for activity, and it may regulate numerous biologic processes through its effects on nitric oxide synthase activity. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DYNLL1P5
Bonobo Pan paniscus DYNLL1P6
Gorilla Gorilla gorilla DYNLL1P6
Orangutan Pongo abelii DYNLL1P6
Gibbon Nomascus leucogenys DYNLL1P1
Baboon Papio anubis DYNLL1P8
Golden snub-nosed monkey Rhinopithecus roxellana DYNLL1P5
Marmoset Callithrix jacchus DYNLL1P10
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>DYNLL1P4
CTAGGTAACCATGTGCAACCTAAAGGCCATAATAAAAAATGCTGACATCTTGGAAGAGATGCAACAGGACTTGGTGGAGTGCACTACTCAGGCGCTAGAGAAATAGAATATAGAGAAGGACATTCCAGCTCATATCAAGAAGGAATTTGACAAGAAGTCCAGTCCCATGCGGCTTGCATCATGGGGAGGAACTTCAGGAGTTATGTGACACATGAAACCAAATGCTTCATCTGTTTCTACCTGGGCCAAGTGGCCACTCTTCTGTTCAAATCTGGTTAAAAGCATGGACTGTACCACGCACCCAGTGATCCATCCGAAATCAAGGACTGCACCCTGAGTCCCAAAAACCAGAGACTGAAATTTTTAGCCTTGA
>NM_001037495.2
AGATGCGCCACGGTTTCGGTAGCGACGGTATCTCTAGCCGGGCCTGAGCTGTGCTAGCACCTCCCCCAGGAGACCGTTGCAGTCGGCCAGCCCCCTTCTCCACGGCCTTGCCCACTAGGTAACCATGTGCGACCGAAAGGCCGTGATCAAAAATGCGGACATGTCGGAAGAGATGCAACAGGACTCGGTGGAGTGCGCTACTCAGGCGCTGGAGAAATACAACATAGAGAAGGACATTGCGGCTCATATCAAGAAGGAATTTGACAAGAAGTACAATCCCACCTGGCATTGCATCGTGGGGAGGAACTTCGGTAGTTATGTGACACATGAAACCAAACACTTCATCTACTTCTACCTGGGCCAAGTGGCCATTCTTCTGTTCAAATCTGGTTAAAAGCATGGACTGTGCCACACACCCAGTGATCCATCCAAAAACAAGGACTGCAGCCTAAATTCCAAATACCAGAGACTGAAATTTTCAGCCTTGCTAAGGGAACATCTCGATGTTTGAACCTTTGTTGTGTTTTGTACAGGGCATTCTCTGTACTAGTTTGTCGTGGTTATAAAACAATTAGCAGAATAGCCTACATTTGTATTTATTTTCTATTCCATACTTCTGCCCACGTTGTTTTCTCTCAAAATCCATTCCTTTAAAAAATAAATCTGATGCAGATGTG

Publications

PMID - Link Title