Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NME2P5
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:14169745-14170001  UCSC
Coordinates (T2T) chr12:14044064-14044320  UCSC
Coordinates (hg19) chr12:14322679-14322935  UCSC
Strand +
Parental Sequence NM_001018137.3
Parental seq. overlap 227 bp
Parental seq. overlap (%) 30.3%
Genomic Region Intergenic
Retrocopy Summary NME2P5, located on chr12:14169745-14170001, is a retrocopy of the parental gene NME2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NME2
Full Name NME/NM23 nucleoside diphosphate kinase 2
Also known as NDKB|NDPK-B|NDPKB|NM23-H2|NM23B|PUF
Coordinate chr17:51165536-51171744
Strand +
Gene summary Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes LOC107969275P4
Bonobo Pan paniscus LOC100979710P4
Gorilla Gorilla gorilla NME2P4
Orangutan Pongo abelii NME2P4
Gibbon Nomascus leucogenys LOC100592128P5
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NME2P5
ATGCATTCAGGTGGGCAGGAACATCATTCATGACAGTGACTGAGTAAAAAGTGTTGAAAAAGAAATCAGCCCATGGTTTAAGCTCAAAGAACCAGCTGACTACAAGTCTTGTGCCTATGACTGGGCCTATGAATAACAGGTGGACACAGCAGCAGTCTCCTTCAGCACTGCTTGGTGTGTCCCTTGATACGGCTCTTCATTCCACTGACATGGAAGCAACAGGATTGATCATTATTTTCTAGAGCATATTTACCAAT
>NM_001018137.3
GAGCTTGTTTGCCAGGGACACTGCAAGTAGGAAGTGTCTACAGGTCGATGACAGGCCTAATCTCTATGACAGGGTCTAGACTTTCCTCAGGGTCCAGGGGCGCACCTCAGGGTGAACTGGAAAACTCGACCGCACTTTAGTGCCAGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATCAAGCGCTTCGAGCAGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAAGAACACCTGAAGCAGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTGAAGTACATGAACTCAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAGACAGGCCGAGTGATGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGTGGGGACTTCTGCATTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGTGCTGAAAAAGAAATCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGGTGTGTCCCTGGACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAGCATATTTGCCAATAAAGCTTTTGGAAGCCGGA

Publications

PMID - Link Title