| Retrocopy Name | NME2P5 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr12:14169745-14170001 UCSC | |
| Coordinates (T2T) | chr12:14044064-14044320 UCSC | |
| Coordinates (hg19) | chr12:14322679-14322935 UCSC | |
| Strand | + | |
| Parental Sequence | NM_001018137.3 | |
| Parental seq. overlap | 227 bp | |
| Parental seq. overlap (%) | 30.3% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | NME2P5, located on chr12:14169745-14170001, is a retrocopy of the parental gene NME2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | NME2 |
| Full Name | NME/NM23 nucleoside diphosphate kinase 2 |
| Also known as | NDKB|NDPK-B|NDPKB|NM23-H2|NM23B|PUF |
| Coordinate | chr17:51165536-51171744 |
| Strand | + |
| Gene summary | Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | LOC107969275P4 |
![]() |
Bonobo | Pan paniscus | LOC100979710P4 |
![]() |
Gorilla | Gorilla gorilla | NME2P4 |
![]() |
Orangutan | Pongo abelii | NME2P4 |
![]() |
Gibbon | Nomascus leucogenys | LOC100592128P5 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >NME2P5 |
| ATGCATTCAGGTGGGCAGGAACATCATTCATGACAGTGACTGAGTAAAAAGTGTTGAAAAAGAAATCAGCCCATGGTTTAAGCTCAAAGAACCAGCTGACTACAAGTCTTGTGCCTATGACTGGGCCTATGAATAACAGGTGGACACAGCAGCAGTCTCCTTCAGCACTGCTTGGTGTGTCCCTTGATACGGCTCTTCATTCCACTGACATGGAAGCAACAGGATTGATCATTATTTTCTAGAGCATATTTACCAAT |
| >NM_001018137.3 |
| GAGCTTGTTTGCCAGGGACACTGCAAGTAGGAAGTGTCTACAGGTCGATGACAGGCCTAATCTCTATGACAGGGTCTAGACTTTCCTCAGGGTCCAGGGGCGCACCTCAGGGTGAACTGGAAAACTCGACCGCACTTTAGTGCCAGGACCATGGCCAACCTGGAGCGCACCTTCATCGCCATCAAGCCGGACGGCGTGCAGCGCGGCCTGGTGGGCGAGATCATCAAGCGCTTCGAGCAGAAGGGATTCCGCCTCGTGGCCATGAAGTTCCTCCGGGCCTCTGAAGAACACCTGAAGCAGCACTACATTGACCTGAAAGACCGACCATTCTTCCCTGGGCTGGTGAAGTACATGAACTCAGGGCCGGTTGTGGCCATGGTCTGGGAGGGGCTGAACGTGGTGAAGACAGGCCGAGTGATGCTTGGGGAGACCAATCCAGCAGATTCAAAGCCAGGCACCATTCGTGGGGACTTCTGCATTCAGGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTAAAAAGTGCTGAAAAAGAAATCAGCCTATGGTTTAAGCCTGAAGAACTGGTTGACTACAAGTCTTGTGCTCATGACTGGGTCTATGAATAAGAGGTGGACACAACAGCAGTCTCCTTCAGCACGGCGTGGTGTGTCCCTGGACACAGCTCTTCATTCCATTGACTTAGAGGCAACAGGATTGATCATTCTTTTATAGAGCATATTTGCCAATAAAGCTTTTGGAAGCCGGA |
| PMID - Link | Title |
|---|