Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFB1P2
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:222945769-222945959  UCSC
Coordinates (T2T) chr1:222179613-222179803  UCSC
Coordinates (hg19) chr1:223119111-223119301  UCSC
Strand +
Parental Sequence NM_004545.4
Parental seq. overlap 160 bp
Parental seq. overlap (%) 50%
Genomic Region Intragenic (DISP1)
Retrocopy Summary NDUFB1P2, located on chr1:222945769-222945959, is a retrocopy of the parental gene NDUFB1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFB1
Full Name NADH:ubiquinone oxidoreductase subunit B1
Also known as CI-MNLL|CI-SGDH|MNLL
Coordinate chr14:92116123-92121706
Strand -
Gene summary Involved in mitochondrial respiratory chain complex I assembly. Located in mitochondrion and nuclear speck. Part of mitochondrial respiratory chain complex I. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFB1P1
Bonobo Pan paniscus NDUFB1P1
Gorilla Gorilla gorilla NDUFB1P1
Orangutan Pongo abelii NDUFB1P1
Green monkey Chlorocebus sabaeus NDUFB1P2
Crab-eating macaque Macaca fascicularis NDUFB1P1
Rhesus Macaca mulatta NDUFB1P1
Baboon Papio anubis NDUFB1P1
Gibbon Nomascus leucogenys Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFB1P2
ACTTGTCCGTATAGGATTTGTCTTTGTATGTTATCTAAAGAGAAAGAATGATGAAAAGCTAACTGCCTTCTGGAAAAATAGTATTTTATTTAAAAGGGAATTGACACCCATGGAGAAGTTGCTTGGAAGTAAAGGCAGTGGCTGAACTATATAATGTTTACATTTTAAAAGTTATGAGAGAAATAAAAACA
>NM_004545.4
ACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAGCTATCATGGTGAACTTACTTCAGATTGTGCGGGACCACTGGGTTCATGTTCTTGTCCCTATGGGATTTGTCATTGGATGTTATTTAGACAGAAAGAGTGATGAACGGCTAACTGCCTTCCGGAACAAGAGTATGTTATTTAAAAGGGAATTGCAACCCAGTGAAGAAGTTACCTGGAAGTAAAGACTGGCTAGATTATCGAATGTTCACATTTTAAAGTTCTGAGAGAAATAAAAACATGAAGAATCTGAAA

Publications

PMID - Link Title