Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name FTH1P2
Wait
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:228687419-228687879  UCSC
Coordinates (T2T) chr1:228065318-228065778  UCSC
Coordinates (hg19) chr1:228823166-228823626  UCSC
Strand +
Parental Sequence NM_002032.3
Parental seq. overlap 448 bp
Parental seq. overlap (%) 37.2%
Genomic Region Intergenic
Retrocopy Summary FTH1P2, located on chr1:228687419-228687879, is a retrocopy of the parental gene FTH1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name FTH1
Full Name ferritin heavy chain 1
Also known as FHC|FTH|FTHL6|HFE5|PIG15|PLIF
Coordinate chr11:61964285-61967634
Strand -
Gene summary This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes FTH1P3
Bonobo Pan paniscus FTH1P2
Gorilla Gorilla gorilla FTH1P3
Orangutan Pongo abelii FTH1P3
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.511.5
log10(TPM+1)

Related Sequence

>FTH1P2
CTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCGATGGAGTGTGCATTACATTTGGAAAAAAGTGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATAAGCAGGTGAAAGCCATCAAAGAATTGGGTGAGCACGTGACCAACTTGTGCAAGATGGGAGCGCCCGAATCTGGCTCGGCGGAATACCTCTTAGACAAGCACACCCTGGGGGACAGTGATAATGAAAGCTAAGCCTCAGGCTAATTTCCACATAGCCGTGGGAGTGACTTCCCTGGTCACCAAG
>NM_002032.3
GCCAGACGTTCTTCGCCGAGAGTCGTCGGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGCGCTCGTTCCCCACCCCGGCCGGCCGCCCATAGCCAGCCCTCCGTCACCTCTTCACCGCACCCTCGGACTGCCCCAAGgcccccgccgccgctccagcgccgcgcagccaccgccgccgccgccgccTCTCCTTAGTCGCCGCCATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAAGCCTCGGGCTAATTTCCCCATAGCCGTGGGGTGACTTCCCTGGTCACCAAGGCAGTGCATGCATGTTGGGGTTTCCTTTACCTTTTCTATAAGTTGTACCAAAACATCCACTTAAGTTCTTTGATTTGTACCATTCCTTCAAATAAAGAAATTTGGTACCCAGGTGTTGTCTTTGAGGTCTTGGGATGAATCAGAAATCTATCCAGGCTATCTTCCAGATTCCTTAAGTGCCGTTGTTCAGTTCTAATCACACTAATCAAAAAGAAACGAGTATTTGTATTTATTAAACTCATTAGTTTGGGCAGTATACTAAGGTGTGGCTGTCTTGGATTCAGATAGAACTAAGGGTTCCCGACTCTGAATCCAGAGTCTGAGTTAAATGTTTCCAATGGTTCAGTCTAGCTTTCACAGTTTTTATGAATAAAAGGCATTAAAGGCTGAA

Publications

PMID - Link Title
9116028Conserved mutations in human ferritin H pseudogenes: a second functional sequence or an evolutionary quirk?
3862645Genes for the 'H' subunit of human ferritin are present on a number of human chromosomes.