Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name MT1HL1
Wait
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:237004046-237004440  UCSC
Coordinates (T2T) chr1:236415059-236415453  UCSC
Coordinates (hg19) chr1:237167346-237167740  UCSC
Strand -
Parental Sequence NM_005951.2
Parental seq. overlap 256 bp
Parental seq. overlap (%) 53.4%
Genomic Region Intergenic
Retrocopy Summary MT1HL1, located on chr1:237004046-237004440, is a retrocopy of the parental gene MT1H. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name MT1H
Full Name metallothionein 1H
Also known as MT-0|MT-1H|MT-IH|MT1
Coordinate chr16:56669814-56671129
Strand +
Gene summary Predicted to enable zinc ion binding activity. Involved in cellular response to cadmium ion and cellular response to zinc ion. Predicted to be active in cytoplasm and nucleus. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes MT1HP1
Bonobo Pan paniscus LOC100987488P1
Gorilla Gorilla gorilla LOC101127721P1
Orangutan Pongo abelii LOC112129345P1
Gibbon Nomascus leucogenys LOC100605310P2
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

Related Sequence

>MT1HL1
AAGTGCAAAAAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGTTGCCCCCTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCCGCAAAGGGGCTTCGGAAAAGTGCAGCTGCTGTGCCTGATGTCGGGACTGCCCTGCTCTCGGATGAAAACAGAATGACACGTAAAGTCCGGGATTTTTTTTTCTACAACCCCGACCCATTTGCTACATTCCTCTTTTTTCTGTGAAATAGGTGAATAATAATTAAACACTTAGACTTGAAACGCCCTCCACGTGTTCCACTGCCTCTTCTCTTCTCGCTTGGGAACGCCGGTCTCACCTCGGCTTGCAATGGACCCCAAc
>NM_005951.2
ACCACGCCCTCCACGTGTTCCACTGCCTCTTCTCTTCTCGCTTGGGAACTCCAGTCTCACCTCGGCTTGCAATGGACCCCAACTGCTCCTGCGAGGCTGGTGGCTCCTGCGCCTGCGCCGGCTCCTGCAAGTGCAAAAAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGTTGCCCCCTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCAGAGAAGTGCAGCTGCTGTGCCTGATGTCGGGACAGCCCTGCTGTCAGATGAAAACAGAATGACACGTAAAATCCAGGATTTTTTTTTTCTACAACTCCGACTCATTTGCTACATTCCTTTTTTTCTGTGAAATATGTGAATAATAATTAAACACTTAGACTTGA

Publications

PMID - Link Title