Retrocopy Name | GSTP1P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr12:55900299-55900700 UCSC | |
Coordinates (T2T) | chr12:55867044-55867445 UCSC | |
Coordinates (hg19) | chr12:56294083-56294484 UCSC | |
Strand | + | |
Parental Sequence | NM_000852.4 | |
Parental seq. overlap | 351 bp | |
Parental seq. overlap (%) | 47.1% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | GSTP1P1, located on chr12:55900299-55900700, is a retrocopy of the parental gene GSTP1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | GSTP1 |
Full Name | glutathione S-transferase pi 1 |
Also known as | DFN7|FAEES3|GST3|GSTP|HEL-S-22|PI |
Coordinate | chr11:67583812-67586653 |
Strand | + |
Gene summary | Glutathione S-transferases (GSTs) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GSTs are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | GSTP1P1 |
![]() |
Bonobo | Pan paniscus | GSTP1P1 |
![]() |
Gorilla | Gorilla gorilla | GSTP1P1 |
![]() |
Orangutan | Pongo abelii | GSTP1P1 |
![]() |
Gibbon | Nomascus leucogenys | LOC100580544P1 |
![]() |
Rhesus | Macaca mulatta | GSTP1P1 |
![]() |
Baboon | Papio anubis | GSTP1P2 |
![]() |
Marmoset | Callithrix jacchus | GSTP1P1 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>GSTP1P1 |
aTACCTCACCCTCATCTATACCAACTACGAGGTGGGCAAGGGTGACTTATGTGAAGGCACTCCCCAGGCAACTGAAGCCTTTTGAGACCCTGCCGTCCCAGAACCAGGGAGGATAGGCCTTCATTGTGGGCGACCAGATATCCCTCGCTTACTACAACCTGCTGGACTTGCTGATCCATGAGGTCCTGGCCACCAGCTGCCTGGATGTGTTCCCCCTGCTCTCGGCCTACATGGCACACCTCAGCGTCCGGCCCAAGCTCAAGGCCTTCCTGGCCTCCACTGAGCACCTGAACCACCCCATCAATGGCAACGGGAAACAGTGAGGGCTGGGGGGACACTCGGCGGGAGGCAGGGGCCGTTTGCCTCCCTTTCTCCAGGACCAACGAAGTTTCTAAGAGA |
>NM_000852.4 |
GCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGTTCGAGGCCGCTGCGCGGCCCTGCGCATGCTGCTGGCAGATCAGGGCCAGAGCTGGAAGGAGGAGGTGGTGACCGTGGAGACGTGGCAGGAGGGCTCACTCAAAGCCTCCTGCCTATACGGGCAGCTCCCCAAGTTCCAGGACGGAGACCTCACCCTGTACCAGTCCAATACCATCCTGCGTCACCTGGGCCGCACCCTTGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAATGACGGCGTGGAGGACCTCCGCTGCAAATACATCTCCCTCATCTACACCAACTATGAGGCGGGCAAGGATGACTATGTGAAGGCACTGCCCGGGCAACTGAAGCCTTTTGAGACCCTGCTGTCCCAGAACCAGGGAGGCAAGACCTTCATTGTGGGAGACCAGATCTCCTTCGCTGACTACAACCTGCTGGACTTGCTGCTGATCCATGAGGTCCTAGCCCCTGGCTGCCTGGATGCGTTCCCCCTGCTCTCAGCATATGTGGGGCGCCTCAGTGCCCGGCCCAAGCTCAAGGCCTTCCTGGCCTCCCCTGAGTACGTGAACCTCCCCATCAATGGCAACGGGAAACAGTGAGGGTTGGGGGGACTCTGAGCGGGAGGCAGAGTTTGCCTTCCTTTCTCCAGGACCAATAAAATTTCTAAGAGAGCTA |
PMID - Link | Title |
---|