Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name GSTP1P1
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:55900299-55900700  UCSC
Coordinates (T2T) chr12:55867044-55867445  UCSC
Coordinates (hg19) chr12:56294083-56294484  UCSC
Strand +
Parental Sequence NM_000852.4
Parental seq. overlap 351 bp
Parental seq. overlap (%) 47.1%
Genomic Region Intergenic
Retrocopy Summary GSTP1P1, located on chr12:55900299-55900700, is a retrocopy of the parental gene GSTP1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name GSTP1
Full Name glutathione S-transferase pi 1
Also known as DFN7|FAEES3|GST3|GSTP|HEL-S-22|PI
Coordinate chr11:67583812-67586653
Strand +
Gene summary Glutathione S-transferases (GSTs) are a family of enzymes that play an important role in detoxification by catalyzing the conjugation of many hydrophobic and electrophilic compounds with reduced glutathione. Based on their biochemical, immunologic, and structural properties, the soluble GSTs are categorized into 4 main classes: alpha, mu, pi, and theta. This GST family member is a polymorphic gene encoding active, functionally different GSTP1 variant proteins that are thought to function in xenobiotic metabolism and play a role in susceptibility to cancer, and other diseases. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes GSTP1P1
Bonobo Pan paniscus GSTP1P1
Gorilla Gorilla gorilla GSTP1P1
Orangutan Pongo abelii GSTP1P1
Gibbon Nomascus leucogenys LOC100580544P1
Rhesus Macaca mulatta GSTP1P1
Baboon Papio anubis GSTP1P2
Marmoset Callithrix jacchus GSTP1P1
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>GSTP1P1
aTACCTCACCCTCATCTATACCAACTACGAGGTGGGCAAGGGTGACTTATGTGAAGGCACTCCCCAGGCAACTGAAGCCTTTTGAGACCCTGCCGTCCCAGAACCAGGGAGGATAGGCCTTCATTGTGGGCGACCAGATATCCCTCGCTTACTACAACCTGCTGGACTTGCTGATCCATGAGGTCCTGGCCACCAGCTGCCTGGATGTGTTCCCCCTGCTCTCGGCCTACATGGCACACCTCAGCGTCCGGCCCAAGCTCAAGGCCTTCCTGGCCTCCACTGAGCACCTGAACCACCCCATCAATGGCAACGGGAAACAGTGAGGGCTGGGGGGACACTCGGCGGGAGGCAGGGGCCGTTTGCCTCCCTTTCTCCAGGACCAACGAAGTTTCTAAGAGA
>NM_000852.4
GCTGGAGTTTCGCCGCCGCAGTCTTCGCCACCATGCCGCCCTACACCGTGGTCTATTTCCCAGTTCGAGGCCGCTGCGCGGCCCTGCGCATGCTGCTGGCAGATCAGGGCCAGAGCTGGAAGGAGGAGGTGGTGACCGTGGAGACGTGGCAGGAGGGCTCACTCAAAGCCTCCTGCCTATACGGGCAGCTCCCCAAGTTCCAGGACGGAGACCTCACCCTGTACCAGTCCAATACCATCCTGCGTCACCTGGGCCGCACCCTTGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAATGACGGCGTGGAGGACCTCCGCTGCAAATACATCTCCCTCATCTACACCAACTATGAGGCGGGCAAGGATGACTATGTGAAGGCACTGCCCGGGCAACTGAAGCCTTTTGAGACCCTGCTGTCCCAGAACCAGGGAGGCAAGACCTTCATTGTGGGAGACCAGATCTCCTTCGCTGACTACAACCTGCTGGACTTGCTGCTGATCCATGAGGTCCTAGCCCCTGGCTGCCTGGATGCGTTCCCCCTGCTCTCAGCATATGTGGGGCGCCTCAGTGCCCGGCCCAAGCTCAAGGCCTTCCTGGCCTCCCCTGAGTACGTGAACCTCCCCATCAATGGCAACGGGAAACAGTGAGGGTTGGGGGGACTCTGAGCGGGAGGCAGAGTTTGCCTTCCTTTCTCCAGGACCAATAAAATTTCTAAGAGAGCTA

Publications

PMID - Link Title