Retrocopy Name | ATP5MFP5 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr12:6270024-6270442 UCSC | |
Coordinates (T2T) | chr12:6277667-6278085 UCSC | |
Coordinates (hg19) | chr12:6379190-6379608 UCSC | |
Strand | - | |
Parental Sequence | NM_001003713.4 | |
Parental seq. overlap | 388 bp | |
Parental seq. overlap (%) | 90.7% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | ATP5MFP5, located on chr12:6270024-6270442, is a retrocopy of the parental gene ATP5MF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | ATP5MF |
Full Name | ATP synthase membrane subunit f |
Also known as | ATP5J2|ATP5JL |
Coordinate | chr7:99458195-99466167 |
Strand | - |
Gene summary | Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | ATP5MFP5 |
![]() |
Bonobo | Pan paniscus | ATP5MFP5 |
![]() |
Gorilla | Gorilla gorilla | ATP5MFP6 |
![]() |
Gibbon | Nomascus leucogenys | ATP5MFP5 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>ATP5MFP5 |
GACACCACGACTCCAAGATGGCGTCAGTCATACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGTTGCCAAGCTGGATCTTGACGCGGGACTTCAGCCCTAGTGGCATTTTCGGAGCATTTCGAAGAAGTTACTACCGGTACTACAACAAGTACATCAATGTGAAGAAGGGGAGCATCTCGGGGGTTACCATGGTGCTGGCATGCTACGTGATCTTCAGCTACTGCCTCTCCTACAAGCATCTCAAGCACGAGCGGCTCCGCAAATGCTACTGAAGAGGACACGCTCTGCACCCCGTACCCCACGACCTTCTAGGCCTGAGCCCCTCCGTGAGGAACACAATCTCGATCGCTGCTGAATCCTTTCATATCCTAATGGGAATTAACCCCCAAATAAAAGATGACTGGTa |
>NM_001003713.4 |
GGCACAGCGGACACCAGGACTCCAAAATGGCGTCAGTTGTACCAGTGAAGGACAAGAAACTTCTGGAGGTCAAACTGGGGGAGCTGCCAAGCTGGATCTTGATGCGGGACTTCAGTCCTAGTGGCATTTTCGGAGCGTTTCAAAGAGGTTACTACCGGTACTACAACAAGTACATCAATGTGAAGAAGGGGAGCATCTCGGGGATTACCATGGTGCTGGCATGCTACGTGCTCTTTAGCTACTCCTTTTCCTACAAGCATCTCAAGCACGAGCGGCTCCGCAAATACCACTGAAGAGGACACACTCTGCACCCCCCCACCCCACGACCTTGGCCCGAGCCCCTCCGTGAGGAACACAATCTCAATCGTTGCTGAATCCTTTCATATCCTAATAGGAATTAACCTCCAAATAAAACATGACTGGTA |
PMID - Link | Title |
---|