| Retrocopy Name | ATP5PDP4 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr12:68642444-68643030 UCSC | |
| Coordinates (T2T) | chr12:68621982-68622568 UCSC | |
| Coordinates (hg19) | chr12:69036224-69036810 UCSC | |
| Strand | - | |
| Parental Sequence | NM_006356.3 | |
| Parental seq. overlap | 566 bp | |
| Parental seq. overlap (%) | 92.8% | |
| Genomic Region |
Intragenic (RAP1B) |
|
| Retrocopy Summary | ATP5PDP4, located on chr12:68642444-68643030, is a retrocopy of the parental gene ATP5PD. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | ATP5PD |
| Full Name | ATP synthase peripheral stalk subunit d |
| Also known as | APT5H|ATP5H|ATPQ |
| Coordinate | chr17:75038863-75046969 |
| Strand | - |
| Gene summary | Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | ATP5PDP3 |
![]() |
Bonobo | Pan paniscus | ATP5PDP3 |
![]() |
Gorilla | Gorilla gorilla | ATP5PDP3 |
![]() |
Orangutan | Pongo abelii | ATP5PDP3 |
![]() |
Gibbon | Nomascus leucogenys | ATP5PDP4 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >ATP5PDP4 |
| GGACCGTGGGCAGCCAGGGTCGGTGAAGAATCCCAACATGGCTGGGCGAAAACTTGCTCTAAAAACCACTGACTGAGTAGCTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTTCCTGAAATCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCGGTTATCGACTGGGCTTACTACAAGGCCAACGTGGCCAAGGCCGGTTTGGTGGATGACTTTAAGAAGTTTAATGCCCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCGCAGGTGGATGCCGAAGAAAAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAACAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCACTGAGGACTTGAACGAAGCTTTCCCAGAAACCAAATTAGACGAGAAAAAGTATCCTTATTGGCCTCACCAACTAATCGAGAATTTATAAAATTGAGTCCAGGAGGAAGTTCTGGCCCTTGTATTACACATTCTGGACATTAAAAATAATAATTATACAG |
| >NM_006356.3 |
| CCGTTACTTGCTGCGGAGGACCGTGGGCAGCCAGGGTCGGTGAAGGATCCCAAAATGGCTGGGCGAAAACTTGCTCTAAAAACCATTGACTGGGTAGCTTTTGCAGAGATCATACCCCAGAACCAAAAGGCCATTGCTAGTTCCCTGAAATCCTGGAATGAGACCCTCACCTCCAGGTTGGCTGCTTTACCTGAGAATCCACCAGCTATCGACTGGGCTTACTACAAGGCCAATGTGGCCAAGGCTGGCTTGGTGGATGACTTTGAGAAGAAGTTTAATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAAAGAAGATGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGATGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCACCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTTGTATTACACATTCTGGACATTAAAAATAATAATTATACA |
| PMID - Link | Title |
|---|