Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name CHCHD3P2
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:72610791-72610961  UCSC
Coordinates (T2T) chr12:72586553-72586723  UCSC
Coordinates (hg19) chr12:73004571-73004741  UCSC
Strand +
Parental Sequence NM_001317178.2
Parental seq. overlap 140 bp
Parental seq. overlap (%) 12.4%
Genomic Region Intragenic (TRHDE)
Retrocopy Summary CHCHD3P2, located on chr12:72610791-72610961, is a retrocopy of the parental gene CHCHD3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name CHCHD3
Full Name coiled-coil-helix-coiled-coil-helix domain containing 3
Also known as MICOS19|MINOS3|Mic19|PPP1R22
Coordinate chr7:132784870-133082090
Strand -
Gene summary The protein encoded by this gene is an inner mitochondrial membrane scaffold protein. Absence of the encoded protein affects the structural integrity of mitochondrial cristae and leads to reductions in ATP production, cell growth, and oxygen consumption. This protein is part of the mitochondrial contact site and cristae organizing system (MICOS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Homology

Species Scientific Name Retrocopy
Gorilla Gorilla gorilla CHCHD3P3
Green monkey Chlorocebus sabaeus LOC103221334P2
Marmoset Callithrix jacchus LOC100412273P3
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>CHCHD3P2
ACAGCAGTATTCTGCTGTTTATGGTGCATCAGTTTTTTCATGAAGATTTAAAAAGAAGAGTACCTGAGGAACTGGCATTGGAGCATGCCCAAAAGAAGATTCTGAAAATCAGAAATGATTAAAGCAAGGTAAAGAACTGGACCAACCAAGAGAGGGCCACTGCCAATGAGC
>NM_001317178.2
AGGACCGGCGCCTTCTCCTTGCTTCTGGGGGTCGTGGCCTTGCTCCCGCTGTGCGGGAAAAGAATCCAGGCCCTTCCACGCGCGTGTGGGTGCGGGGGCCCCGAAGTGCTCGTGGTTCCCCGCTAGGTCTCCGCTGGGGCAGGAACCGGAATCATGGGTGGGACCACCAGCACCCGCCGGGTCACCTTCGAGGCGGACGAGAATGAGAACATCACCGTGGTGAAGGGCATCCGGCTTTCGGAAAATGTGATTGATCGAATGAAGGAATCCTCTCCATCTGGTTCGAAGTCTCAGCGGTATTCTGGTGCTTATGGTGCCTCAGTTTCTGATGAAGAATTGAAAAGAAGAGTAGCTGAGGAGCTGGCATTGGAGCAAGCCAAGAAAGAATCCGAAGATCAGAAACGACTAAAGCAAGCCAAAGAGCTGGACCGAGAGAGGGCTGCTGCCAATGAGCAGTTAACCAGAGCCATCCTTCGGGAGAGGATATGTAGCGAGGAGGAACGCGCTAAGGCAAAGCACCTGataaaagtggagctgctctgggtgaaacctggagtgttgactgcttagcctccacttcggccttcctagaaacccagatgttactcctcggaacctttagtcctcattggagcacagttgggaactcactgGACAGGGAAAATGGGACCATGGAATGGAGAACTTTGAACTGAAGAGTGAGGGGGATTTTCCTAGTTCACTAGGCAATTGGGAAACACTAAAACTTTCTAAGAAGAAGGCTCATTTCTAGTCTCTCCCATTCTTTACCTTAGTCACTTCTCTGAAAGACCAACCCATGACCAGCTGCAAACAGAGAACATGAAAGGAAGTCCATGCGTAATGAATCAGTTTCTTCAGTGACAAATCTGGGGTCCCGGTTGCATGGGCAAATAGTGAAGCCAGAATAGAGGTGGTAGACCAAGAAAGAAATGTCAGTGGACTGACTGGCAGCTGCCCTAAGAACAGTACATGTGTTGAGTGGAACAAAGGGAATAAGAGAGGTGGAAGCAAAGTCAGTCATTGTGAAAGGGGAATAATTTCAGAATTAAAGACAGTAAGTTTTGAGTAACTCAACTGAAAATTAAATTTGTTGTACGT

Publications

PMID - Link Title