| Retrocopy Name | SNRPGP20 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr12:79988970-79989195 UCSC | |
| Coordinates (T2T) | chr12:79967629-79967854 UCSC | |
| Coordinates (hg19) | chr12:80382750-80382975 UCSC | |
| Strand | - | |
| Parental Sequence | NM_003096.4 | |
| Parental seq. overlap | 184 bp | |
| Parental seq. overlap (%) | 30.6% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | SNRPGP20, located on chr12:79988970-79989195, is a retrocopy of the parental gene SNRPG. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | SNRPG |
| Full Name | small nuclear ribonucleoprotein polypeptide G |
| Also known as | SMG|Sm-G |
| Coordinate | chr2:70281362-70293740 |
| Strand | - |
| Gene summary | The protein encoded by this gene is a component of the U1, U2, U4, and U5 small nuclear ribonucleoprotein complexes, precursors of the spliceosome. The encoded protein may also be a part of the U7 small nuclear ribonucleoprotein complex, which participates in the processing of the 3' end of histone transcripts. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | SNRPGP9 |
![]() |
Bonobo | Pan paniscus | SNRPGP9 |
![]() |
Gorilla | Gorilla gorilla | SNRPGP15 |
![]() |
Orangutan | Pongo abelii | SNRPGP10 |
![]() |
Gibbon | Nomascus leucogenys | SNRPGP8 |
![]() |
Green monkey | Chlorocebus sabaeus | SNRPGP9 |
![]() |
Crab-eating macaque | Macaca fascicularis | SNRPGP11 |
![]() |
Rhesus | Macaca mulatta | SNRPGP12 |
![]() |
Baboon | Papio anubis | SNRPGP6 |
![]() |
Horse | Equus caballus | SNRPGP5 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >SNRPGP20 |
| AAAAAATTATGCACAAGAAGTAGTCATTAAAATTAAGTTGTGTCAGACATGCCAAAGGAATACTGTGGTGATCTGATCCCTTTATGAATATTTGATGAATGTGTGGAGATCACAACTAGTGGGCAATGGAACAATATCGGAATGGTGGTAGATAAATGGAAGGAAATATTATCATGTTAGAAACCTCAGAAAAAGTATAAATAATGGCCGAGTTCAGCAGAGAAAT |
| >NM_003096.4 |
| GCCAGACGCAAGACGCCGGGCCTACAGCGGGAGCGTGAGGAAAGCCGTGCGTTGCGTTCCAAGGCATCTGTGAGCCCGCGGAGTATACACCATGAGCAAAGCTCACCCTCCCGAGTTGAAAAAATTTATGGACAAGAAGTTATCATTGAAATTAAATGGTGGCAGACATGTCCAAGGAATATTGCGGGGATTTGATCCCTTTATGAACCTTGTGATAGATGAATGTGTGGAGATGGCGACTAGTGGACAACAGAACAATATTGGAATGGTGGTAATACGAGGAAATAGTATCATCATGTTAGAAGCCTTGGAACGAGTATAAATAATGGCTGTTCAGCAGAGAAACCCATGTCCTCTCTCCATAGGGCCTGTTTTACTATGATGTAAAAATTAGGTCATGTACATTTTCATATTAGACTTTTTGTTAAATAAACTTTTGTAATAGTCAAAAATGCTTTCTCAGATGTTCTGAATATAGAATATCAGCTCTCATTCCAGTTTTTTCTAACATGAATTTTCCTGGTTGACATTGATTTCAAAGGGTTTTATGCATTAAAGTGAAAGAATCTTATTAAATGTGAAACATGGCAAGGA |
| PMID - Link | Title |
|---|