Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PSME2P2
Wait
Plot displaying the genomic locations of a retrocopy (in chr13) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr13:48771095-48771870  UCSC
Coordinates (T2T) chr13:47991180-47991955  UCSC
Coordinates (hg19) chr13:49345231-49346006  UCSC
Strand +
Parental Sequence NM_002818.3_2
Parental seq. overlap 747 bp
Parental seq. overlap (%) 94.1%
Genomic Region Intergenic
Retrocopy Summary PSME2P2, located on chr13:48771095-48771870, is a retrocopy of the parental gene PSME2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PSME2
Full Name proteasome activator subunit 2
Also known as PA28B|PA28beta|REGbeta
Coordinate chr14:24143365-24146646
Strand -
Gene summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the beta subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three beta and three alpha subunits combine to form a heterohexameric ring. Six pseudogenes have been identified on chromosomes 4, 5, 8, 10 and 13. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PSME2P6
Bonobo Pan paniscus PSME2P6
Gorilla Gorilla gorilla PSME2P6
Orangutan Pongo abelii PSME2P6
Gibbon Nomascus leucogenys PSME2P2
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.511.5
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>PSME2P2
AGAGACCAGAGATCTAGCAACTGAAGCAGCACGGCCAAGCCATGTAGGGTGCGCCTGAGCGCAAACAGGTGGAGGTCTTCCTTCCTTTTCCAGGAGGCTGAGGAATTCCTCTACAGATTCTTGCCACAGAAAATCACATACCTGAATCAGCTCTTGCGAGAGGGCTCCCTCAGTGTGGCTGACCTGACTTCCCTCCGGGCCCCACTGGACATCCCCAACCCAGACCCTCCACCCAAGGATGATGAGATGGAAACAGATAAGTAGGAGAAGAAAGAAGTCCCTAAGTGTGGATTTCTCCCTGGGAATAAGAAAGTCCTGTCCCTGCTTGCCCTGGTTAAGCCAGAATTCTGGACTCTCAAAGAGAAATTCATTCTGGTGATTACATGGATCCAGCACCTAATCCCCAAGATTGAAGATGGAAATGATTTTGGGGTAGCAATCCAGGAGAAGGTGCTGGAGAGGGTGAATGCTGTCAAGACCAAAGTGGAAGCTTTCCAGACAACCATTTCCAAGTAATTCTCAGAACGTGGGGATGCTGCGGCCAAGGCCTCCGAGGAGACTCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAGGCAGCCTATGGGGAGCTCAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAACAGCAACCTGGAGAAAATTGTCAACCCAAAGGGTGAAAAGAAGCCATCTATGTACTGAACCCAGGACTAGAAGGAAAATAAATGATCTATATGTTGTGT
>NM_002818.3_2
GAGACCAGAGATCTAGCGACTGAAGCAGCATGGCCAAGCCGTGTGGGGTGCGCCTGAGCGGGGAAGCCCGCAAACAGGTGGAGGTCTTCAGACAGAATCTTTTCCAGGAGGCTGAGGAATTCCTCTACAGATTCTTGCCACAGAAAATCATATACCTGAATCAGCTCTTGCAAGAGGACTCCCTCAATGTGGCTGACTTGACTTCCCTCCGGGCCCCACTGGACATCCCCATCCCAGACCCTCCACCCAAGGATGATGAGATGGAAACAGATAAGCAGGAGAAGAAAGAAGTCCATAAGTGTGGATTTCTCCCTGGGAATGAGAAAGTCCTGTCCCTGCTTGCCCTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAATGCATTCTGGTGATTACATGGATCCAACACCTGATCCCCAAGATTGAAGATGGAAATGATTTTGGGGTAGCAATCCAGGAGAAGGTGCTGGAGAGGGTGAATGCCGTCAAGACCAAAGTGGAAGCTTTCCAGACAACCATTTCCAAGTACTTCTCAGAACGTGGGGATGCTGTGGCCAAGGCCTCCAAGGAGACTCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAGGCAGCCTATGGGGAGCTCAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAGCAGCAACCTGGAGAAAATTGTCAACCCAAAGGGTGAAGAAAAGCCATCTATGTACTGAACCCGGGACTAGAAGGAAAATAAATGATCTATATGTTGTGTGGA

Publications

PMID - Link Title
No publications available for this retrocopy