| Retrocopy Name | POLR3KP1 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr13:59071110-59071625 UCSC | |
| Coordinates (T2T) | chr13:58290868-58291383 UCSC | |
| Coordinates (hg19) | chr13:59645244-59645759 UCSC | |
| Strand | - | |
| Parental Sequence | NM_016310.5 | |
| Parental seq. overlap | 431 bp | |
| Parental seq. overlap (%) | 31.3% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | POLR3KP1, located on chr13:59071110-59071625, is a retrocopy of the parental gene POLR3K. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | POLR3K |
| Full Name | RNA polymerase III subunit K |
| Also known as | C11|C11-RNP3|HLD21|My010|RPC10|RPC11|RPC12.5 |
| Coordinate | chr16:46407-53608 |
| Strand | - |
| Gene summary | This gene encodes a small essential subunit of RNA polymerase III, the polymerase responsible for synthesizing transfer and small ribosomal RNAs in eukaryotes. The carboxy-terminal domain of this subunit shares a high degree of sequence similarity to the carboxy-terminal domain of an RNA polymerase II elongation factor. This similarity in sequence is supported by functional studies showing that this subunit is required for proper pausing and termination during transcription. Pseudogenes of this gene are found on chromosomes 13 and 17.[provided by RefSeq, Jul 2010] |
| Species | Scientific Name | Retrocopy | |
![]() |
Bonobo | Pan paniscus | POLR3KP1 |
![]() |
Gorilla | Gorilla gorilla | POLR3KP1 |
![]() |
Orangutan | Pongo abelii | POLR3KP1 |
![]() |
Gibbon | Nomascus leucogenys | POLR3KP1 |
![]() |
Green monkey | Chlorocebus sabaeus | POLR3KP1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | POLR3KP1 |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >POLR3KP1 |
| GAGCAACTGCCTAGGAGAATGTCCACTGTCCTGCCCAGCCATGTCCCCAGTGCGAACACCCTCCTGTTCACTTCATGCAGCACAAGACTCACCCTGCAGATGAGCCAATGACTGCCTTCTACAAGGGCAGCAGTGCTCAGTGTGGACACTGCTGGGGGAATTAGGGCCAGGATGGCCCAGCTGCCTCAGTGTCTGCTTACCTTGTCCCCCAGGGTGGATTCTCAGCTGGGAGTATGAATTGTGGGTACTGAGGATCTTTTCTGGTGGAAAGCTAACTCTTTTAGAGTGAAGAGCCAAAGTCTTAGTAACTGTAGCCTATCTGCCAGTCAGGGAGTTTTTGTGTGTGGAGAGGAGACCCATAGCTAAGTAAGCTCTGTTTAAAGTCCTGTTCTTTCACCTTTCATATTTATTGGCAGTTGACATTTCCTCACCACCAGTCAACATTCTTAAATACTTGTACTGTTTCCACAACTTAGTACACTGTCCCTAAATATTTAACTATTAATTGTAAACTTA |
| >NM_016310.5 |
| GGAGCCTGCGGAGTTCGAGACCATGCTGCTGTTCTGCCCCGGCTGCGGGAACGGGCTGATCGTGGAGGAGGGACAACGCTGCCACCGCTTCGCCTGCAACACGTGCCCCTACGTGCACAACATCACCCGCAAGGTAACAAATCGGAAGTACCCAAAACTGAAAGAAGTGGATGATGTGCTTGGTGGAGCAGCTGCCTGGGAGAATGTTGACTCTACTGCAGAGTCGTGTCCCAAATGCGAACATCCTCGTGCTTACTTCATGCAGCTTCAGACCCGCTCTGCAGATGAGCCGATGACCACCTTCTACAAGTGCTGCAATGCTCAGTGTGGACACCGCTGGAGGGATTAGGGCCAGGATGGCCCAGCTGCCCTAGTGTGTGCTTGCCTTGTCCCTCGGGGTAGATGCTTAGCTGGCAGTATGAGTTGTGTGTCCTGAGGGTCTTTGCTAGTGTGGTGGAAAGATAAACCTTTTGAGGTGAAGAGCCAGGGGGTCAGGAAATATGGCCTATCTGCCAGGCAGGGTGGATGAAGTCATGAATGTCTGGGAGTTTTTCTGTGTGGGGAGGAGACAGAGACCCATAACTAAATATGCTCTGTGTAAAGTCCTATTCTTTCATCTTCCACTTTATTGGCAGTTGACATTCCCTTACTCCCAATCAACACTCTTAAATATTTGTACTGTTTGTAAAACTTAGTACATGTCCCTAAATATTTAACTGTTACTTGTAAACTTGTGTAATTTATTATTTATTTTAATCAAAATTCTGAATATTTCATTTAAATGAAAGTTGGAATATTGCCTTCTCAGTGTTTTAAATAGCTTAAGAGGTAGAAAGCAAACCCCAAATCACAGTGATCCCAGAATAGACTACATACTTACATTTGAACAGGCTACGAAAATGTTAATCACCGGGATTTCAATTTCTTTCTTTATTCCTATTCTTACTCCCTTATTCATTTTTTTGAACCTCCCCTGATTTGCTTCCTCGGGTTGCTTTAAATGTATAAGATACtatttatttatttatttattttatttatttatttatttatttaagacagagtcttgttctgtcgcccaggctggagtgcagtggtacgaattcagctcactgcaacctctgccttccgggttcaagggattctcctgtctcagcctcccaagcagctgggactacaggcatgcaccaccacacctgggtaattttgcatttttagtagagatggggtttctccatgttggtcgggctggtctccaactcctgacctcagataatctgtctgcctcggcctcctaaagtgctgggattacaggcgtgagccactgtgtccCACCAATCTTTACATTTAATATGACTATTTTCTTATTGTT |
| PMID - Link | Title |
|---|