Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name BRK1P2
Wait
Plot displaying the genomic locations of a retrocopy (in chr13) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr13:91023757-91023934  UCSC
Coordinates (T2T) chr13:90226335-90226512  UCSC
Coordinates (hg19) chr13:91676011-91676188  UCSC
Strand -
Parental Sequence NM_018462.5
Parental seq. overlap 143 bp
Parental seq. overlap (%) 12.4%
Genomic Region Intergenic
Retrocopy Summary BRK1P2, located on chr13:91023757-91023934, is a retrocopy of the parental gene BRK1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name BRK1
Full Name BRICK1 subunit of SCAR/WAVE actin nucleating complex
Also known as C3orf10|HSPC300|MDS027|hHBrk1
Coordinate chr3:10115675-10127190
Strand +
Gene summary Enables identical protein binding activity. Contributes to small GTPase binding activity. Involved in Rac protein signal transduction and positive regulation of cellular component organization. Located in extracellular exosome. Part of SCAR complex. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes BRK1P1
Bonobo Pan paniscus BRK1P1
Gorilla Gorilla gorilla BRK1P1
Orangutan Pongo abelii BRK1P1
Gibbon Nomascus leucogenys BRK1P1
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.050.10.150.2
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth012
log10(TPM+1)

Related Sequence

>BRK1P2
GGTGCAGTGAGAGATTCACCAGCACTGGGAAATCCAGGATTGCATTGAGTTTATCACCAGCAGCAACAAGAAAATTGTAAACTTTCTCAACTTGTTTCATATGTCATGTCCTTTAAGACTCCTAATTCTATATGAGAAGCTGACAGCCCTTGAATGGAGAATAAAATACACTGAAGCA
>NM_018462.5
GCAGTCGCTCTTCCTCAGGCGGCGGCCATGGCGGGACAGGAGGATCCGGTGCAGCGGGAGATTCACCAGGACTGGGCTAACCGGGAGTACATTGAGATAATCACCAGCAGCATCAAGAAAATCGCAGACTTTCTCAACTCGTTCGATATGTCTTGTCGTTCAAGACTTGCAACACTAAACGAGAAATTGACAGCCCTTGAACGGAGAATAGAGTACATTGAAGCTCGGGTGACAAAAGGTGAGACACTCACCTAGAACAGTGCCGTGCTGCTGCTGGGAAGTTGCTTTACACAACACAGGCCACATGGGAAAGGCCCCAGCAGCCTTCAGCTCCTTCCTTTCTCCTTAAAGAGCAACAGGGCTTATTCTTGTTTTTCTTTTTTCAAAAGTGTGGCCTTTGGGCTCTGCCATCTGGGGTGTGGTGTGGTATGTGGGAAGAAGTTCAGAGGAACCGTTGGAAACGACGTTAGGCATTTTACCTTTTCAGTAACATTTTATACATCTACTTGTCAATGTATTTGAGACATTCACAGCCAAAAGCCTGGGACTCTTTGTGAAGGTCctcctcacctctatctttctttctctctctctcAAACTTTCCTTAAAGTTCTCATTGCCTTTGCACTGCTTCTGTGAACAGTCTTTGTCTCCTCCCCACCTTTGGTGGGAAGTGCGGGGCAGTCCTGGTCAAGACACTCATGCCCTGGCAATGTGGCTGCCAGAGAATGTTGTTGCTAACCCACCAGTTTCTTGTTGATTTGGAGAGGTCAAGGCCAGGCCCCCACTTGGCTTGAAGGGACATTTTCAGACTTTTCTTTCTGTCACTTGGAGTGTCTATGCCTCTCATATTTCCCTAATAAACTCCTCAACTTTTTATCTGACTGCTGTGATTATGGTGGGGAGAGGAGCTAGAGATGGGTTCACTTATTGCACAGAAATGTAATACATGGCGTTATTATTCTAACATAAAACTTTCAGATGTAGCTGTTTGATTCAAAGCCTAGGTGGCTTACCAGCCCAAGTCCCCATGTTTGGACTTTCAGCTGACTAGCTCATCTTGGGAATCatttggtcattcagcacatttaccaagtatttactatgtaggcatgttaaactccaataaaacatacagcattgaatcaga

Publications

PMID - Link Title
No publications available for this retrocopy