Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name FTLP8
Wait
Plot displaying the genomic locations of a retrocopy (in chr13) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr13:97986959-97987217  UCSC
Coordinates (T2T) chr13:97193802-97194060  UCSC
Coordinates (hg19) chr13:98639213-98639471  UCSC
Strand -
Parental Sequence NM_000146.4
Parental seq. overlap 220 bp
Parental seq. overlap (%) 25%
Genomic Region Intragenic (IPO5)
Retrocopy Summary FTLP8, located on chr13:97986959-97987217, is a retrocopy of the parental gene FTL. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name FTL
Full Name ferritin light chain
Also known as LFTD|NBIA3
Coordinate chr19:48965309-48966879
Strand +
Gene summary This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes FTLP4
Bonobo Pan paniscus FTLP5
Gorilla Gorilla gorilla FTLP6
Orangutan Pongo abelii FTLP5
Gibbon Nomascus leucogenys FTLP2
Green monkey Chlorocebus sabaeus FTLP4
Crab-eating macaque Macaca fascicularis FTLP14
Rhesus Macaca mulatta FTLP14
Golden snub-nosed monkey Rhinopithecus roxellana FTLP15
Marmoset Callithrix jacchus FTLP1
Baboon Papio anubis Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.10.20.30.4
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>FTLP8
TGAAGATGAGTGGGACAAAACCCAAGACACCATGGAAGCTGTCATGGCCCTGGAGAAGAACTTGTACCAGGAACCAGGCCCTGTTGGATCTTCATGCCCTGGGTTCTGCCTGCACAGATCCCCATCTCTGTGACTTCTTGGAGAGCCACTTCCTAGATGAGGAAGTGAAACTCATTAAGATGGGTGACCACGTGACCAACCTCCGCAGGCTAGTTGGCTCCTATGTTGAGCTGGGCAAGTGTCTCTTCAAAAGGCTCAT
>NM_000146.4
GCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGATCCGGGGACTCTCTTCCAGCCTCCGACCGCCCTCCGATTTCCTCTCCGCTTGCAACCTCCGGGACCATCTTCTCGGCCATCTCCTGCTTCTGGGACCTGCCAGCACCGTTTTTGTGGTTAGCTCCTTCTTGCCAACCAACCATGAGCTCCCAGATTCGTCAGAATTATTCCACCGACGTGGAGGCAGCCGTCAACAGCCTGGTCAATTTGTACCTGCAGGCCTCCTACACCTACCTCTCTCTGGGCTTCTATTTCGACCGCGATGATGTGGCTCTGGAAGGCGTGAGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCTACGAGCGTCTCCTGAAGATGCAAAACCAGCGTGGCGGCCGCGCTCTCTTCCAGGACATCAAGAAGCCAGCTGAAGATGAGTGGGGTAAAACCCCAGACGCCATGAAAGCTGCCATGGCCCTGGAGAAAAAGCTGAACCAGGCCCTTTTGGATCTTCATGCCCTGGGTTCTGCCCGCACGGACCCCCATCTCTGTGACTTCCTGGAGACTCACTTCCTAGATGAGGAAGTGAAGCTTATCAAGAAGATGGGTGACCACCTGACCAACCTCCACAGGCTGGGTGGCCCGGAGGCTGGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAAGAGCCTTCTGAGCCCAGCGACTTCTGAAGGGCCCCTTGCAAAGTAATAGGGCTTCTGCCTAAGCCTCTCCCTCCAGCCAATAGGCAGCTTTCTTAACTATCCTAACAAGCCTTGGACCAAATGGAAATAAAGCTTTTTGATGCA

Publications

PMID - Link Title
No publications available for this retrocopy