Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL17P2
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr18). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:60212462-60212934  UCSC
Coordinates (T2T) chr14:54418758-54419230  UCSC
Coordinates (hg19) chr14:60679180-60679652  UCSC
Strand -
Parental Sequence NM_001035006.5
Parental seq. overlap 416 bp
Parental seq. overlap (%) 67.8%
Genomic Region Intergenic
Retrocopy Summary RPL17P2, located on chr14:60212462-60212934, is a retrocopy of the parental gene RPL17. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL17
Full Name ribosomal protein L17
Also known as L17|PD-1|RPL23
Coordinate chr18:49488481-49492465
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L22P family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as rpL23 because the encoded protein shares amino acid identity with ribosomal protein L23 from Halobacterium marismortui; however, its official symbol is RPL17. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream C18orf32 (chromosome 18 open reading frame 32) gene. [provided by RefSeq, Dec 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL17P37
Bonobo Pan paniscus RPL17P39
Gorilla Gorilla gorilla RPL17P40
Orangutan Pongo abelii LOC103892985P33
Gibbon Nomascus leucogenys RPL17P1
Green monkey Chlorocebus sabaeus RPL17P50
Crab-eating macaque Macaca fascicularis LOC101867070P21
Rhesus Macaca mulatta RPL17P21
Baboon Papio anubis RPL17P25
Golden snub-nosed monkey Rhinopithecus roxellana RPL17P19
Marmoset Callithrix jacchus RPL17P37
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL17P2
CCTGAGGTGATCTGTGAAAATAGTTCACTATTCACTTGACCCAGAAAATCCCACAAAATTATGCAAATCAAGAGGTTCAAATCTTTGTGTTCACTTTCAGAACACTCATGAAACTGCCCAGGCCATCAGGGGTATGCATATACAAAAAGCCCCAAGTATCTGAAAGACGTCACTTTACAGAAGCAGGGTGTACCATTCCGACATTTCAGGGGGGGAGTTGTTGGGTGTGCCCAGGCCAAGCAGTGGGGCTGATGGGGTTGGTGGCCCAAAAAGCTTGCTGAATTTTTGCTGCACATGCTTAAAAGTGCAGAGGGTAATGCTGAGCTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCTAGGTGAACAAAGCACATAAAATGCATTACTGGACTTACAGAACACGTAGTCAGATTAACTCATACATGAGCTCTCCCTGCCACATCGAGATGATCCTTACTGAAAC
>NM_001035006.5
AGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGGAAAAGAA

Publications

PMID - Link Title