Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL7AP106
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr9). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:68338667-68339549  UCSC
Coordinates (T2T) chr14:62545112-62545994  UCSC
Coordinates (hg19) chr14:68805384-68806266  UCSC
Strand -
Parental Sequence NM_000972.3_2
Parental seq. overlap 810 bp
Parental seq. overlap (%) 90.7%
Genomic Region Intragenic (RAD51B)
Retrocopy Summary RPL7AP106, located on chr14:68338667-68339549, is a retrocopy of the parental gene RPL7A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL7A
Full Name ribosomal protein L7a
Also known as L7A|SURF3|TRUP
Coordinate chr9:133348218-133351426
Strand +
Gene summary Cytoplasmic ribosomes, organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L7AE family of ribosomal proteins. It can interact with a subclass of nuclear hormone receptors, including thyroid hormone receptor, and inhibit their ability to transactivate by preventing their binding to their DNA response elements. This gene is included in the surfeit gene cluster, a group of very tightly linked genes that do not share sequence similarity. It is co-transcribed with the U24, U36a, U36b, and U36c small nucleolar RNA genes, which are located in its second, fifth, fourth, and sixth introns, respectively. This gene rearranges with the trk proto-oncogene to form the chimeric oncogene trk-2h, which encodes an oncoprotein consisting of the N terminus of ribosomal protein L7a fused to the receptor tyrosine kinase domain of trk. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL7AP55
Bonobo Pan paniscus RPL7AP55
Gorilla Gorilla gorilla RPL7AP56
Orangutan Pongo abelii RPL7AP58
Gibbon Nomascus leucogenys RPL7AP7
Green monkey Chlorocebus sabaeus LOC103240161P37
Crab-eating macaque Macaca fascicularis RPL7AP35
Rhesus Macaca mulatta RPL7AP35
Baboon Papio anubis RPL7AP34
Golden snub-nosed monkey Rhinopithecus roxellana RPL7AP21
Marmoset Callithrix jacchus LOC100392033P47
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL7AP106
TCTCTCCTCCCGCCACCCAAGATGCTGAAAGGAAAGAAAGCCAAGGAGAAAAAATGGCTCCAGCTCCTGCTGTCATAAAGAAGCAGGAGGCCAAGGAAGTGGTGAATCCCCTGTTTGAGAAAAGGCTTAAGAATTTTGGCATTGGACAGGATATCCAGCCCCAAAGAGACCTCACCCGCTTTGTGAAATGGCCCCACTATATCAGGTTGCAGCGGCAGAGAGCCATCCTCTGTAAGTGGATGTAAGTGCCTCCTGCCATTAACCAGTTCACCCAGGCCCTGGACCACCAAACAGCTACTCAGCTGCTTAAGCTGGCCCACAAGTACAGGCCAGAGACAAAGCAAGAGAAGAAGCAGAGGCTGTTGGCCCAGGCCAAGAAGAAAGCTACCAGCAAAGGGGACATCCCCACTAAGAGACCACCTGTCCTTCGAGCAGGAGTTAACATGGTCACCACCTTGGTGGAGAACAAGAAAGCTCAGCTGGTGATGACTGCACACGATGTCGATCCCATCGAGCTGGCTGTCTTCTGCCTGCCTGCCCCATGTTGTAAAAAGGGGGTCCCTTACTGCATTATCAAGGGGAAGGCAAGACTGGGACATCTAGTCCACAGGAAGACCTGCACCACTGTTGTCTTCACAAAGGTTAACTCGGAAGACAAAGGAGCTTTGGCTAAGCTGGTGGAAGCTATCAGGACCAACTACGACAGATACGATGAGATCCACTGTCACTGGGGAGGCAATGTCCTGGGTCTCAAGTCTGTAGCTCACATTATCAAGCTCGAAAAGGCAAAGGTTAAAGAACTTTGCCACTGAACTGGGTTAAATGTACACTGTTGAGTTTTCTGTCCATAAAAATAATTAAAATAATACAAAATTTCCTTCAA
>NM_000972.3_2
CTTTCTCTCTCCTCCCGCCGCCCAAGATGCCGAAAGGAAAGAAGGCCAAGGGAAAGAAGGTGGCTCCGGCCCCAGCTGTCGTGAAGAAGCAGGAGGCTAAGAAAGTGGTGAATCCCCTGTTTGAGAAAAGGCCTAAGAATTTTGGCATTGGACAGGACATCCAGCCCAAAAGAGACCTCACCCGCTTTGTGAAATGGCCCCGCTATATCAGGTTGCAGCGGCAGAGAGCCATCCTCTATAAGCGGCTGAAAGTGCCTCCTGCGATTAACCAGTTCACCCAGGCCCTGGACCGCCAAACAGCTACTCAGCTGCTTAAGCTGGCCCACAAGTACAGACCAGAGACAAAGCAAGAGAAGAAGCAGAGACTGTTGGCCCGGGCCGAGAAGAAGGCTGCTGGCAAAGGGGACGTCCCAACGAAGAGACCACCTGTCCTTCGAGCAGGAGTTAACACCGTCACCACCTTGGTGGAGAACAAGAAAGCTCAGCTGGTGGTGATTGCACACGACGTGGATCCCATCGAGCTGGTTGTCTTCTTGCCTGCCCTGTGTCGTAAAATGGGGGTCCCTTACTGCATTATCAAGGGAAAGGCAAGACTGGGACGTCTAGTCCACAGGAAGACCTGCACCACTGTCGCCTTCACACAGGTGAACTCGGAAGACAAAGGCGCTTTGGCTAAGCTGGTGGAAGCTATCAGGACCAATTACAATGACAGATACGATGAGATCCGCCGTCACTGGGGTGGCAATGTCCTGGGTCCTAAGTCTGTGGCTCGTATCGCCAAGCTCGAAAAGGCAAAGGCTAAAGAACTTGCCACTAAACTGGGTTAAATGTACACTGTTGAGTTTTCTGTACATAAAAATAATTGAAATAATACAAATTTTCCTTCA

Publications

PMID - Link Title