Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name RPL24P12
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:69561097-69561502  UCSC
Coordinates (T2T) chr14:63768781-63769186  UCSC
Coordinates (hg19) chr14:70027814-70028219  UCSC
Strand -
Parental Sequence NM_000986.4
Parental seq. overlap 350 bp
Parental seq. overlap (%) 62.5%
Genomic Region Intergenic
Retrocopy Summary RPL24P12, located on chr14:69561097-69561502, is a retrocopy of the parental gene RPL24. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL24
Full Name ribosomal protein L24
Also known as HEL-S-310|L24
Coordinate chr3:101681091-101686718
Strand -
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L24E family of ribosomal proteins. It is located in the cytoplasm. This gene has been referred to as ribosomal protein L30 because the encoded protein shares amino acid identity with the L30 ribosomal proteins from S. cerevisiae; however, its official name is ribosomal protein L24. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL24P7
Bonobo Pan paniscus RPL24P6
Gorilla Gorilla gorilla RPL24P8
Orangutan Pongo abelii RPL24P5
Gibbon Nomascus leucogenys RPL24P2
Green monkey Chlorocebus sabaeus RPL24P5
Crab-eating macaque Macaca fascicularis RPL24P6
Rhesus Macaca mulatta RPL24P6
Baboon Papio anubis RPL24P6
Golden snub-nosed monkey Rhinopithecus roxellana RPL24P5
Marmoset Callithrix jacchus RPL24P7
Mouse lemur Microcebus murinus RPL13AP2
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPL24P12
GCCATCTTTTCTTTTCCCCTGGAGCTGCCACCATGAAGGTCAAGTTGTACAGTTTAAGCGGGTACAAGGTCTACCCTAGACATGGAAGGCGCTACACCAGGACGGACAGGGAGGTTTTCCAGTTTCTTAACGTAAAGTACACGTCAGCTTTCCTTTCCAAGAGGGACCGTTAGTAGATAAACCGGATTGTCCTCTACAGAAGAAAGCACAAAAAGGGACATTTGGAAGAAATTCAGAAGAAAAGAAACTGCCAAGCAGTCAGATTCCAGGGGGCCATTAGTGATGCATCTCTTGCTGATCTAATGGCCAAGAGGAATCAGAAATTTGAAGTTAAAGAGGCTCAACGAGAACAAGCTCGCAGGGCTGCTAAGGAAGCAAAATAGGCTAAGCAAGCATCGAAAAAGAT
>NM_000986.4
CTTTCTTTTCGCCATCTTTTGTCTTTCCGTGGAGCTGTCGCCATGAAGGTCGAGCTGTGCAGTTTTAGCGGGTACAAGATCTACCCCGGACACGGGAGGCGCTACGCCAGGACCGACGGGAAGGTTTTCCAGTTTCTTAATGCGAAATGCGAGTCGGCTTTCCTTTCCAAGAGGAATCCTCGGCAGATAAACTGGACTGTCCTCTACAGAAGGAAGCACAAAAAGGGACAGTCGGAAGAAATTCAAAAGAAAAGAACCCGCCGAGCAGTCAAATTCCAGAGGGCCATTACTGGTGCATCTCTTGCTGATATAATGGCCAAGAGGAATCAGAAACCTGAAGTTAGAAAGGCTCAACGAGAACAAGCTATCAGGGCTGCTAAGGAAGCAAAAAAGGCTAAGCAAGCATCTAAAAAGACTGCAATGGCTGCTGCTAAGGCACCTACAAAGGCAGCACCTAAGCAAAAGATTGTGAAGCCTGTGAAAGTTTCAGCTCCCCGAGTTGGTGGAAAACGCTAAACTGGCAGATTAGATTTTTAAATAAAGATTGGATTATAACTCTA

Publications

PMID - Link Title