Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL13AP41
Wait
Plot displaying the genomic locations of a retrocopy (in chr14) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr14:84951185-84951401  UCSC
Coordinates (T2T) chr14:79164839-79165055  UCSC
Coordinates (hg19) chr14:85417529-85417745  UCSC
Strand +
Parental Sequence NM_012423.4
Parental seq. overlap 196 bp
Parental seq. overlap (%) 17.4%
Genomic Region Intergenic
Retrocopy Summary RPL13AP41, located on chr14:84951185-84951401, is a retrocopy of the parental gene RPL13A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL13A
Full Name ribosomal protein L13a
Also known as L13A|TSTA1
Coordinate chr19:49487608-49492308
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL13AP26
Bonobo Pan paniscus RPL13AP28
Gorilla Gorilla gorilla RPL13AP24
Orangutan Pongo abelii RPL13AP26
Green monkey Chlorocebus sabaeus RPL13AP23
Crab-eating macaque Macaca fascicularis RPL13AP10
Rhesus Macaca mulatta RPL13AP10
Baboon Papio anubis RPL13AP11
Golden snub-nosed monkey Rhinopithecus roxellana RPL13AP8
Gibbon Nomascus leucogenys Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Related Sequence

>RPL13AP41
TCTGGCTCACAAGGTTGGCTAGAAGTATCAGGCAATGACAGCTACCCTGGAGGAGAAGAGAAATGAGAAGACCAAATTCCACTACCATAAGAAACAGCTCATGAGGCTACGGAAACAGGCCGAAAAGAACTTGGAGAAGAAAATTGACCAACACACAGAGGTCCTCAAGACCCTTGGACTCCTGGTCTGAGCCCACTAAAGACTGTTTATTCCTCAT
>NM_012423.4
CTTTTCCAAGCGGCTGCCGAAGATGGCGGAGGTGCAGGTCCTGGTGCTTGATGGTCGAGGCCATCTCCTGGGCCGCCTGGCGGCCATCGTGGCTAAACAGGTACTGCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTGGCAATTTCTACAGAAACAAGTTGAAGTACCTGGCTTTCCTCCGCAAGCGGATGAACACCAACCCTTCCCGAGGCCCCTACCACTTCCGGGCCCCCAGCCGCATCTTCTGGCGGACCGTGCGAGGTATGCTGCCCCACAAAACCAAGCGAGGCCAGGCCGCTCTGGACCGTCTCAAGGTGTTTGACGGCATCCCACCGCCCTACGACAAGAAAAAGCGGATGGTGGTTCCTGCTGCCCTCAAGGTCGTGCGTCTGAAGCCTACAAGAAAGTTTGCCTATCTGGGGCGCCTGGCTCACGAGGTTGGCTGGAAGTACCAGGCAGTGACAGCCACCCTGGAGGAGAAGAGGAAAGAGAAAGCCAAGATCCACTACCGGAAGAAGAAACAGCTCATGAGGCTACGGAAACAGGCCGAGAAGAACGTGGAGAAGAAAATTGACAAATACACAGAGGTCCTCAAGACCCACGGACTCCTGGTCTGAGCCCAATAAAGACTGTTAATTCCTCATGCGTTGCCTGCCCTTCCTCCATTGTTGCCCTGGAATGTACGGGACCCAGGGGCAGCAGCAGTCCAGGTGCCACAGGCAGCCCTGGGACATAGGAAGCTGGGAGCAAGGAAAGGGTCTTAGTCACTGCCTCCCGAAGTTGCTTGAAAGCACTCGGAGAATTGTGCAGGTGTCATTTATCTATGACCAATAGGAAGAGCAACCAGTTACTATGAGTGAAAGGGAGCCAGAAGACTGATTGGAGGGCCCTATCTTGTGAGTGGGGCATCTGTTGGACTTTCCACCTGGTCATATACTCTGCAGCTGTTAGAATGTGCAAGCACTTGGGGACAGCATGAGCTTGCTGTTGTACACAGGGTATTTCTAGAAGCAGAAATAGACTGGGAAGATGCACAACCAAGGGGTTACAGGCATCGCCCATGCTCCTCACCTGTATTTTGTAATCAGAAATAAATTGCTTTTAAAGAAA

Publications

PMID - Link Title
No publications available for this retrocopy