Retrocopy Name | FTLP20 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr15:28858262-28858498 UCSC | |
Coordinates (T2T) | chr15:26635269-26635505 UCSC | |
Coordinates (hg19) | chr15:29103408-29103644 UCSC | |
Strand | - | |
Parental Sequence | NM_000146.4 | |
Parental seq. overlap | 193 bp | |
Parental seq. overlap (%) | 21.9% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | FTLP20, located on chr15:28858262-28858498, is a retrocopy of the parental gene FTL. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | FTL |
Full Name | ferritin light chain |
Also known as | LFTD|NBIA3 |
Coordinate | chr19:48965309-48966879 |
Strand | + |
Gene summary | This gene encodes the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in this light chain ferritin gene are associated with several neurodegenerative diseases and hyperferritinemia-cataract syndrome. This gene has multiple pseudogenes. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Gibbon | Nomascus leucogenys | FTLP4 |
![]() |
Green monkey | Chlorocebus sabaeus | FTLP13 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | FTLP1 |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Bonobo | Pan paniscus | Without Homology |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>FTLP20 |
TTGCAACCTCCAGGACCATCTTCTCAGCCATCTCCTGCTTCCAGGACCAGCCAACACCGTTGTGTTAGAAATAAGGTTAGCTCCTTATTGCCAACCAACCACAAGCTCCCAGATTCGTCAGAATGATTCCACCGAGGAGGAAGCTGCAGTCAGCTGCCTGGTCCATGTGCATCGGCGGGTGTCCTGCACTTACCATTCCCTGGGCTTCTATTTCAACCACAATGAGTGGCTCTGGAG |
>NM_000146.4 |
GCAGTTCGGCGGTCCCGCGGGTCTGTCTCTTGCTTCAACAGTGTTTGGACGGAACAGATCCGGGGACTCTCTTCCAGCCTCCGACCGCCCTCCGATTTCCTCTCCGCTTGCAACCTCCGGGACCATCTTCTCGGCCATCTCCTGCTTCTGGGACCTGCCAGCACCGTTTTTGTGGTTAGCTCCTTCTTGCCAACCAACCATGAGCTCCCAGATTCGTCAGAATTATTCCACCGACGTGGAGGCAGCCGTCAACAGCCTGGTCAATTTGTACCTGCAGGCCTCCTACACCTACCTCTCTCTGGGCTTCTATTTCGACCGCGATGATGTGGCTCTGGAAGGCGTGAGCCACTTCTTCCGCGAATTGGCCGAGGAGAAGCGCGAGGGCTACGAGCGTCTCCTGAAGATGCAAAACCAGCGTGGCGGCCGCGCTCTCTTCCAGGACATCAAGAAGCCAGCTGAAGATGAGTGGGGTAAAACCCCAGACGCCATGAAAGCTGCCATGGCCCTGGAGAAAAAGCTGAACCAGGCCCTTTTGGATCTTCATGCCCTGGGTTCTGCCCGCACGGACCCCCATCTCTGTGACTTCCTGGAGACTCACTTCCTAGATGAGGAAGTGAAGCTTATCAAGAAGATGGGTGACCACCTGACCAACCTCCACAGGCTGGGTGGCCCGGAGGCTGGGCTGGGCGAGTATCTCTTCGAAAGGCTCACTCTCAAGCACGACTAAGAGCCTTCTGAGCCCAGCGACTTCTGAAGGGCCCCTTGCAAAGTAATAGGGCTTCTGCCTAAGCCTCTCCCTCCAGCCAATAGGCAGCTTTCTTAACTATCCTAACAAGCCTTGGACCAAATGGAAATAAAGCTTTTTGATGCA |
PMID - Link | Title |
---|