Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PSMB3P3
Plot displaying the genomic locations of a retrocopy (in chr15) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr15:45610649-45610812  UCSC
Coordinates (T2T) chr15:43418811-43418974  UCSC
Coordinates (hg19) chr15:45902847-45903010  UCSC
Strand -
Parental Sequence NM_002795.4_2
Parental seq. overlap 151 bp
Parental seq. overlap (%) 19.8%
Genomic Region Intergenic
Retrocopy Summary PSMB3P3, located on chr15:45610649-45610812, is a retrocopy of the parental gene PSMB3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PSMB3
Full Name proteasome 20S subunit beta 3
Also known as HC10-II
Coordinate chr17:38752741-38764225
Strand +
Gene summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants [provided by RefSeq, Sep 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PSMB3P3
Bonobo Pan paniscus PSMB3P3
Gorilla Gorilla gorilla PSMB3P3
Orangutan Pongo abelii PSMB3P3
Gibbon Nomascus leucogenys PSMB3P1
Green monkey Chlorocebus sabaeus PSMB3P2
Crab-eating macaque Macaca fascicularis PSMB3P1
Rhesus Macaca mulatta PSMB3P1
Baboon Papio anubis PSMB3P1
Golden snub-nosed monkey Rhinopithecus roxellana PSMB3P1
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>PSMB3P3
CATCTCTCAAGCCATGCTGGATGCTGCGGACCAGGATGCAGTGTCAGACATGGGAGTTATTGTCCACATCATTGAAAAGGACAAAATCACCACCAGGATTGAAGGCCTGAATGGACTAACCCTGTTCGCAGAGCCCACTTTTTTTTTTTTAATAAAATAGCCTT
>NM_002795.4_2
AGCAGTGAGAGCGGTTGCGCAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGATCCTAGTACACCGCAATCATGTCTATTATGTCCTATAACGGAGGGGCCGTCATGGCCATGAAGGGGAAGAACTGTGTGGCCATCGCTGCAGACAGGCGCTTCGGGATCCAGGCCCAGATGGTGACCACGGACTTCCAGAAGATCTTTCCCATGGGTGACCGGCTGTACATCGGTCTGGCCGGGCTCGCCACTGACGTCCAGACAGTTGCCCAGCGCCTCAAGTTCCGGCTGAACCTGTATGAGTTGAAGGAAGGTCGGCAGATCAAACCTTATACCCTCATGAGCATGGTGGCCAACCTCTTGTATGAGAAACGGTTTGGCCCTTACTACACTGAGCCAGTCATTGCCGGGTTGGACCCGAAGACCTTTAAGCCCTTCATTTGCTCTCTAGACCTCATCGGCTGCCCCATGGTGACTGATGACTTTGTGGTCAGTGGCACCTGCGCCGAACAAATGTACGGAATGTGTGAGTCCCTCTGGGAGCCCAACATGGATCCGGATCACCTGTTTGAAACCATCTCCCAAGCCATGCTGAATGCTGTGGACCGGGATGCAGTGTCAGGCATGGGAGTCATTGTCCACATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGACTAACCCTGTTCCCAGAGCCCACTTTTTTTTCTTTTTTTGAAATAAAATAGCCTGTCTTTCA

Publications

PMID - Link Title