Retrocopy Name | PSMB3P3 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr15:45610649-45610812 UCSC | |
Coordinates (T2T) | chr15:43418811-43418974 UCSC | |
Coordinates (hg19) | chr15:45902847-45903010 UCSC | |
Strand | - | |
Parental Sequence | NM_002795.4_2 | |
Parental seq. overlap | 151 bp | |
Parental seq. overlap (%) | 19.8% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | PSMB3P3, located on chr15:45610649-45610812, is a retrocopy of the parental gene PSMB3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | PSMB3 |
Full Name | proteasome 20S subunit beta 3 |
Also known as | HC10-II |
Coordinate | chr17:38752741-38764225 |
Strand | + |
Gene summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. The 26 S proteasome may be involved in trinucleotide repeat expansion, a phenomenon which is associated with many hereditary neurological diseases. Pseudogenes have been identified on chromosomes 2 and 12. Alternative splicing results in multiple transcript variants [provided by RefSeq, Sep 2013] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | PSMB3P3 |
![]() |
Bonobo | Pan paniscus | PSMB3P3 |
![]() |
Gorilla | Gorilla gorilla | PSMB3P3 |
![]() |
Orangutan | Pongo abelii | PSMB3P3 |
![]() |
Gibbon | Nomascus leucogenys | PSMB3P1 |
![]() |
Green monkey | Chlorocebus sabaeus | PSMB3P2 |
![]() |
Crab-eating macaque | Macaca fascicularis | PSMB3P1 |
![]() |
Rhesus | Macaca mulatta | PSMB3P1 |
![]() |
Baboon | Papio anubis | PSMB3P1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | PSMB3P1 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>PSMB3P3 |
CATCTCTCAAGCCATGCTGGATGCTGCGGACCAGGATGCAGTGTCAGACATGGGAGTTATTGTCCACATCATTGAAAAGGACAAAATCACCACCAGGATTGAAGGCCTGAATGGACTAACCCTGTTCGCAGAGCCCACTTTTTTTTTTTTAATAAAATAGCCTT |
>NM_002795.4_2 |
AGCAGTGAGAGCGGTTGCGCAGTGAAGGCTAGACCCGGTTTACTGGAATTGCTCTGGCGATCGAGGGATCCTAGTACACCGCAATCATGTCTATTATGTCCTATAACGGAGGGGCCGTCATGGCCATGAAGGGGAAGAACTGTGTGGCCATCGCTGCAGACAGGCGCTTCGGGATCCAGGCCCAGATGGTGACCACGGACTTCCAGAAGATCTTTCCCATGGGTGACCGGCTGTACATCGGTCTGGCCGGGCTCGCCACTGACGTCCAGACAGTTGCCCAGCGCCTCAAGTTCCGGCTGAACCTGTATGAGTTGAAGGAAGGTCGGCAGATCAAACCTTATACCCTCATGAGCATGGTGGCCAACCTCTTGTATGAGAAACGGTTTGGCCCTTACTACACTGAGCCAGTCATTGCCGGGTTGGACCCGAAGACCTTTAAGCCCTTCATTTGCTCTCTAGACCTCATCGGCTGCCCCATGGTGACTGATGACTTTGTGGTCAGTGGCACCTGCGCCGAACAAATGTACGGAATGTGTGAGTCCCTCTGGGAGCCCAACATGGATCCGGATCACCTGTTTGAAACCATCTCCCAAGCCATGCTGAATGCTGTGGACCGGGATGCAGTGTCAGGCATGGGAGTCATTGTCCACATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGACTAACCCTGTTCCCAGAGCCCACTTTTTTTTCTTTTTTTGAAATAAAATAGCCTGTCTTTCA |
PMID - Link | Title |
---|