Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name VKORC1P2
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:58228410-58229005  UCSC
Coordinates (T2T) chr1:58107248-58107843  UCSC
Coordinates (hg19) chr1:58694082-58694677  UCSC
Strand -
Parental Sequence NM_024006.6
Parental seq. overlap 538 bp
Parental seq. overlap (%) 64%
Genomic Region Intragenic (OMA1)
Intragenic (DAB1)
Intragenic (DNAAF3)
Retrocopy Summary VKORC1P2, located on chr1:58228410-58229005, is a retrocopy of the parental gene VKORC1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name VKORC1
Full Name vitamin K epoxide reductase complex subunit 1
Also known as EDTP308|MST134|MST576|VKCFD2|VKOR
Coordinate chr16:31090854-31094797
Strand -
Gene summary This gene encodes the catalytic subunit of the vitamin K epoxide reductase complex, which is responsible for the reduction of inactive vitamin K 2,3-epoxide to active vitamin K in the endoplasmic reticulum membrane. Vitamin K is a required co-factor for carboxylation of glutamic acid residues by vitamin K-dependent gamma-carboxylase in blood-clotting enzymes. Allelic variation in this gene is associated with vitamin k-dependent clotting factors combined deficiency of 2, and increased resistance or sensitivity to warfarin, an inhibitor of vitamin K epoxide reductase. Pseudogenes of this gene are located on chromosomes 1 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes VKORC1P1
Bonobo Pan paniscus VKORC1P1
Gorilla Gorilla gorilla VKORC1P1
Orangutan Pongo abelii VKORC1P1
Gibbon Nomascus leucogenys VKORC1P1
Green monkey Chlorocebus sabaeus VKORC1P1
Rhesus Macaca mulatta VKORC1P1
Baboon Papio anubis VKORC1P1
Golden snub-nosed monkey Rhinopithecus roxellana VKORC1P2
Marmoset Callithrix jacchus VKORC1P2
Crab-eating macaque Macaca fascicularis Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>VKORC1P2
CCAGGTGGGACAGGGGCTTCGGGCTGGTGGAGCATGTGCTGTGACAGGACAGCATCCTCAGTCAATCTAGCAGCATATTTGATTGCATTTTCTACACACTACAGCTGTTGTTAGGTTGCCTGCGGATGCTCTGGGCCTCTGTCCTGCTGGTGCTGAGCTCCCTGGTGTCTCTTGCTGGTTATGTCTACCTGGACTGGATCCTGTTCTTTGTGCTCTATGATTTCTGTCTTGTTTGCATAACCACCTATGCCATCAACGTGGGCCTGATGTGGCTCAGTTTCCAGAAGGTCCAAGAACCCCAGGGCAAGGCTAAGAGGTACTGAGCCCTCACCCCAAGCCAGGCTGGCCTCATTTGCTTTGCTTTGGCATGTGAACCTCGCACAAGGGGGCATATCTGGGTCCCAAGAAAGCCCTAGATGCAGGGCTTCCTAGAGTCCCCCCTCCCCCTGCCATATCCACACACGATAATGGACCAAGTGTACCATACACTTGCTCTTTTTTCCACCCAGTGCCTCTGACTCTGTCCCCAAAGGCTGGTCTCCAAAGTTCTTGCCATTGCCCAGGGAGGGAAGGTTCTGAGCAATAAAATTTCTTAA
>NM_024006.6
ATTCGCCGCCCGGCCCCTGCTCCGTGGCTGGTTTTCTCCGCGGGCGCCTCGGGCGGAACCTGGAGATAATGGGCAGCACCTGGGGGAGCCCTGGCTGGGTGCGGCTCGCTCTTTGCCTGACGGGCTTAGTGCTCTCGCTCTACGCGCTGCACGTGAAGGCGGCGCGCGCCCGGGACCGGGATTACCGCGCGCTCTGCGACGTGGGCACCGCCATCAGCTGTTCGCGCGTCTTCTCCTCCAGGTGGGGCAGGGGTTTCGGGCTGGTGGAGCATGTGCTGGGACAGGACAGCATCCTCAATCAATCCAACAGCATATTCGGTTGCATCTTCTACACACTACAGCTATTGTTAGGTTGCCTGCGGACACGCTGGGCCTCTGTCCTGATGCTGCTGAGCTCCCTGGTGTCTCTCGCTGGTTCTGTCTACCTGGCCTGGATCCTGTTCTTCGTGCTCTATGATTTCTGCATTGTTTGTATCACCACCTATGCTATCAACGTGAGCCTGATGTGGCTCAGTTTCCGGAAGGTCCAAGAACCCCAGGGCAAGGCTAAGAGGCACTGAGCCCTCAACCCAAGCCAGGCTGACCTCATCTGCTTTGCTTTGGCATGTGAGCCTTGCCTAAGGGGGCATATCTGGGTCCCTAGAAGGCCCTAGATGTGGGGCTTCTAGATTACCCCCTCCTCCTGCCATACCCGCACATGACAATGGACCAAATGTGCCACACGCTCGCTCTTTTTTACACCCAGTGCCTCTGACTCTGTCCCCATGGGCTGGTCTCCAAAGCTCTTTCCATTGCCCAGGGAGGGAAGGTTCTGAGCAATAAAGTTTCTTAGATCAATCA

Publications

PMID - Link Title