Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFA3P6
Plot displaying the genomic locations of a retrocopy (in chr16) and its respective parental gene (in chr19_GL949746v1_alt). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr16:31174588-31174885  UCSC
Coordinates (T2T) chr16:31562019-31562316  UCSC
Coordinates (hg19) chr16:31185909-31186206  UCSC
Strand +
Parental Sequence NM_004542.4_9
Parental seq. overlap 259 bp
Parental seq. overlap (%) 27.4%
Genomic Region Intergenic
Retrocopy Summary NDUFA3P6, located on chr16:31174588-31174885, is a retrocopy of the parental gene NDUFA3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFA3
Full Name NADH:ubiquinone oxidoreductase subunit A3
Also known as B9|CI-B9
Coordinate chr19_GL949746v1_alt:77276-81988
Strand +
Gene summary Involved in mitochondrial respiratory chain complex I assembly. Located in mitochondrion. Part of mitochondrial respiratory chain complex I. [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Bonobo Pan paniscus NDUFA3P7
Orangutan Pongo abelii NDUFA3P4
Gibbon Nomascus leucogenys NDUFA3P1
Green monkey Chlorocebus sabaeus NDUFA3P2
Crab-eating macaque Macaca fascicularis NDUFA3P7
Rhesus Macaca mulatta NDUFA3P7
Baboon Papio anubis NDUFA3P6
Golden snub-nosed monkey Rhinopithecus roxellana NDUFA3P6
Chimpanzee Pan troglodytes Without Homology
Gorilla Gorilla gorilla Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFA3P6
ACCTTCCTCAAGATTTCCTGGGCCAAGGAGCCAGTGCTGGTCTTGTCCTCTGTCATCCGGAGCCTCACTGTAATTCTACCCCCACTTAGTCCCCACACCAAGTACTCCATCATGATCAACGAGGCAAGGCCCTACAACTACCCAGTGCCTGTCTGCAATGATGGGAACATGCCCGATGTGCCCAGCCACCCCCAGGACCCCCAAGGCCCCAGTTTGGAGTGGCTGAAGAAATTGTGAGCACCTCCACTGCCAAAGGAGGACCCTCCCATGGCTCCCACTAGAAATGTGAAAACCAACC
>NM_004542.4_9
GCTGTCGCCGCCGCGGAGACAAAGATGGCTGCGAGAGTCGGCGCCTTCCTCAAGAATGCCTGGGACAAGGAGCCAGTGCTGGTCGTGTCCTTCGTCGTCGGGGGCCTCGCTGTAATTCTGCCCCCATTGAGCCCCTACTTCAAGTACTCCGTCATGATCAACAAGGCCACGCCCTACAACTACCCAGTGCCCGTCCGTGATGATGGGAACATGCCCGACGTGCCCAGCCACCCCCAGGACCCTCAGGGCCCCAGCCTGGAGTGGCTGAAGAAACTGTGAGCACCTCCACTGACAGAGGCGGCCCCTCCCACGGCTCCCAATAAAAATGTGAAAACCAACCCCCGAACGTGAGCATGTGTGTGATCAGAGGTGGGAACAAGTAGACGGTGGCCGGGGTGAGTGTGGGGTCAGTTTATTGGGCATGCGTCAGTCAGAGGCTGGGCTGGCCAGGGTCGGGTAGGGCAGCAGTTTGTCTGGACCCCGAGAAACCCAACTGGAATCCAGGGCCTCATCTGCTTCAAAGCCAAAGTCTTCCTCAACCTTAATCTGCAGGAGATAAGGAACAAGGTGTTAACAGGCCTGGGAATCTAGAAAATCCCATCAGCTTCACCAtttttgttttcattttgttttgctttttaaagagacagggtctcactctgttgcccaggctggagtgcagtggtgccatcatagttcactgcagcctctgcctcccaggctcaagtgatcctcccacctcagcttcccaagtagctgggactacaggcacttgccaaccaagcctaacatgttttttctttttggtagagatggggtctcagtatgttgctcaggcaggtctcagactcctggcctcaagtgatcctcccacctaggcctcccaaagtgccgggattacaggcatgagccactgcacctggccAGCCTCACAGTTCTTGTCTG

Publications

PMID - Link Title