Retrocopy Name | DBIP3 |
![]() |
Species | Homo sapiens | |
Coordinates (hg38) | chr16:4130594-4131033 UCSC | |
Coordinates (T2T) | chr16:4157919-4158358 UCSC | |
Coordinates (hg19) | chr16:4180595-4181034 UCSC | |
Strand | + | |
Parental Sequence | NM_020548.9 | |
Parental seq. overlap | 374 bp | |
Parental seq. overlap (%) | 54.9% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | DBIP3, located on chr16:4130594-4131033, is a retrocopy of the parental gene DBI. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | DBI |
Full Name | diazepam binding inhibitor, acyl-CoA binding protein |
Also known as | ACBD1|ACBP|CCK-RP|EP |
Coordinate | chr2:119366977-119372543 |
Strand | + |
Gene summary | This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | DBIP3 |
![]() |
Bonobo | Pan paniscus | DBIP3 |
![]() |
Gorilla | Gorilla gorilla | DBIP3 |
![]() |
Gibbon | Nomascus leucogenys | DBIP3 |
![]() |
Green monkey | Chlorocebus sabaeus | DBIP2 |
![]() |
Rhesus | Macaca mulatta | DBIP4 |
![]() |
Baboon | Papio anubis | DBIP4 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | DBIP4 |
![]() |
Marmoset | Callithrix jacchus | DBIP3 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>DBIP3 |
AGCACTTTAAGACCAAGCCAGCAGATGATGAGATGCGGTTCCTCTACGGCCACTACAAACGAGCGACTGTAGGCAACATAAAGACAGAACGGCCCAGGATGGTGGACTTCAAGGGCAAAGCCAAGTGAGATCCCTGGAATTAGCTGAAAGGGGCTGCCAGGGAAGATCCCATGAAAGCTAAAGCTTACGTCAACAAAGTAGAAGAGTTAAAGAAAAAATTCAGAATACGAGAGACTGGAATTGGTTGCCAGCCATGCCTTTGTCCTAAACTGAGACAATGCCTTGTTTTTTCTAACACTGTGGATGGTGGGAACTGATGGAAAGAATCAGCTAACCCATCCTCAAGGCTACTCAGGATAAAGTTCTAATAGATTAGGGGCTAAAACGATTACTGACCTTCCCTCAGTAGTTTTTATCTGAGATCAATTAAGTGTATTTGT |
>NM_020548.9 |
AGTGCAATCTGGGCGATCGCTTCCTGGTCCTCGCCTCCTCCGCTGTCTCCCTGGAGTTCTTGCAAGTCGGCCAGGATGTCTCAGGTACAGCGCGTGCACAGCCAGGCTGCGAAGACCCTTGTCTGAGACCGAGCTATGTGGGGCGACCTCTGGCTCCTCCCGCCTGCCTCTGCCAATCCGGGCACTGGGACAGAGGCTGAGTTTGAGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAGCCATCGGATGAGGAGATGCTGTTCATCTATGGCCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAAGAGCTAAAGAAAAAATACGGGATATGAGAGACTGGATTTGGTTACTGTGCCATGTGTTTATCCTAAACTGAGACAATGCCTTGTTTTTTTCTAATACCGTGGATGGTGGGAATTCGGGAAAATAACCAGTTAAACCAGCTACTCAAGGCTGCTCACCATACGGCTCTAACAGATTAGGGGCTAAAACGATTACTGACTTTCCTTGAGTAGTTTTTATCTGAAATCAATTAAAAGTGTATTTGTTACTTTAAA |
PMID - Link | Title |
---|---|
No publications available for this retrocopy |