Retrocopy Name | UBA52P8 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr16:48334383-48334849 UCSC | |
Coordinates (T2T) | chr16:54131642-54132108 UCSC | |
Coordinates (hg19) | chr16:48368294-48368760 UCSC | |
Strand | - | |
Parental Sequence | XM_005260054.2 | |
Parental seq. overlap | 410 bp | |
Parental seq. overlap (%) | 70.2% | |
Genomic Region |
Intragenic (LONP2) |
|
Retrocopy Summary | UBA52P8, located on chr16:48334383-48334849, is a retrocopy of the parental gene UBA52. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | UBA52 |
Full Name | ubiquitin A-52 residue ribosomal protein fusion product 1 |
Also known as | CEP52|HUBCEP52|L40|RPL40 |
Coordinate | chr19:18563766-18577550 |
Strand | + |
Gene summary | Ubiquitin is a highly conserved nuclear and cytoplasmic protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein L40 at the C terminus, a C-terminal extension protein (CEP). Multiple processed pseudogenes derived from this gene are present in the genome. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | UBA52P11 |
![]() |
Bonobo | Pan paniscus | UBA52P13 |
![]() |
Gorilla | Gorilla gorilla | UBA52P12 |
![]() |
Orangutan | Pongo abelii | UBA52P11 |
![]() |
Gibbon | Nomascus leucogenys | UBA52P4 |
![]() |
Green monkey | Chlorocebus sabaeus | UBA52P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | UBA52P15 |
![]() |
Rhesus | Macaca mulatta | UBA52P14 |
![]() |
Baboon | Papio anubis | UBA52P13 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | UBA52P16 |
![]() |
Marmoset | Callithrix jacchus | UBA52P32 |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>UBA52P8 |
GATCTTTGTGAAGACCCTCACAGGCCAGACCATCACCCTTGAGGTCGAGCCCAGTGATGCCACTGAGAATGTCAAAGCCAAAATTCAAGACAGGTAGGGCATCTTACCTGACCAGCAGTGTCTGATATTTGAGGGCAAACAGCTGAAGGATGGCCACACACTCTTAGACTACAACATCCAGAAAGAGTCCACCCTGCGCCTGATGCTGTGCCTGTGAGGTGGCATTACGGAGCCTTCCCTCTGCCACCTTGCCCAGAAATACAACTGCAAGAAGATGATGTGCCACAAGAGCTGTGCTCGCCTGCGCCCCCATGCAGTCAACTGCTGCAAGAAGTGCGGCCACACCAACAACCTGCGTCCCAAAAAGAAGGTCGAATAAGGCTATTCCTTCCCCAAAGGGCAGCCTCCTGCCCAGGCCCTACGGCCCTGGGGCCTCAATAAAGTGTTCCTTTCATTGACTGGAGCAA |
>XM_005260054.2 |
tgctgggattacagACGCAAACATGCAGATCTTTGTGAAGACCCTCACTGGCAAAACCATCACCCTTGAGGTCGAGCCCAGTGACACCATTGAGAATGTCAAAGCCAAAATTCAAGACAAGGAGGGTATCCCACCTGACCAGCAGCGTCTGATATTTGCCGGCAAACAGCTGGAGGATGGCCGCACTCTCTCAGACTACAACATCCAGAAAGAGTCCACCCTGCACCTGGTGTTGCGCCTGCGAGGTGGCATTATTGAGCCTTCTCTCCGCCAGCTTGCCCAGAAATACAACTGCGACAAGATGATCTGCCGCAAGTATGTGTGCTCCGATGCTTGGGGGGCTGTGGGGGCTGCCGGAGTCGGGGTATGCCCTCACCCACCCCTCCTGTCTCTGTGCAGGTGCTATGCTCGCCTTCACCCTCGTGCTGTCAACTGCCGCAAGAAGAAGTGTGGTCACACCAACAACCTGCGTCCCAAGAAGAAGGTCAAATAAGGTGGTTCTTTCCTTGAAGGGCAGCCTCCTGCCCAGGCCCCGTGGCCCTGGAGCCTCAATAAAGTGTCCCTTTCATTGACTGGAGCAGCAA |
PMID - Link | Title |
---|