Retrocopy Name | HSPE1P7 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr16:74612525-74612883 UCSC | |
Coordinates (T2T) | chr16:80659255-80659613 UCSC | |
Coordinates (hg19) | chr16:74646423-74646781 UCSC | |
Strand | - | |
Parental Sequence | NM_002157.3 | |
Parental seq. overlap | 337 bp | |
Parental seq. overlap (%) | 60.4% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | HSPE1P7, located on chr16:74612525-74612883, is a retrocopy of the parental gene HSPE1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | HSPE1 |
Full Name | heat shock protein family E (Hsp10) member 1 |
Also known as | CPN10|EPF|GROES|HSP10 |
Coordinate | chr2:197500379-197503449 |
Strand | + |
Gene summary | This gene encodes a major heat shock protein which functions as a chaperonin. Its structure consists of a heptameric ring which binds to another heat shock protein in order to form a symmetric, functional heterodimer which enhances protein folding in an ATP-dependent manner. This gene and its co-chaperonin, HSPD1, are arranged in a head-to-head orientation on chromosome 2. Naturally occurring read-through transcription occurs between this locus and the neighboring locus MOBKL3.[provided by RefSeq, Feb 2011] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | HSPE1P27 |
![]() |
Bonobo | Pan paniscus | LOC100982477P26 |
![]() |
Gorilla | Gorilla gorilla | LOC101151505P27 |
![]() |
Orangutan | Pongo abelii | HSPE1P22 |
![]() |
Rhesus | Macaca mulatta | HSPE1P24 |
![]() |
Baboon | Papio anubis | LOC101019904P24 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | LOC104676747P30 |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>HSPE1P7 |
GTTTCTTCCACTCTTTGAGCGAGTACTGGTTGAAAGGAGCGCTGCTGAAACTGTAACCAGAGGAGGCATTATGCTTCCAGAAAAATCTCAAGGAAAAGTATTGCAAGCAATAGTAGTCGCTGTTGGATCGGGTTCTAAAGGAAAAGGTGGAGAGATTCAACCAGTTAGCATGAAAGTTGGAGATAAAGTTCTTCTCCCAGAACATGGAGGCACCAAAGTAATTCTAGATGACAAGGATTATTTCCTATTTAGAGATGGTGACATTCTTGGAAAGTATGTAGACTGAAATAAGACACTATTGAAAATGGCAGCAACATGAAGCTGCCCATTCCACTGAAGTTCTGAAATCTT |
>NM_002157.3 |
GCGAGTCTCTTTGCGGCGCTACACTAGAGCAGAGTACGAGTCTGAGGCGGAGGGAGTAATGGCAGGACAAGCGTTTAGAAAGTTTCTTCCACTCTTTGACCGAGTATTGGTTGAAAGGAGTGCTGCTGAAACTGTAACCAAAGGAGGCATTATGCTTCCAGAAAAATCTCAAGGAAAAGTATTGCAAGCAACAGTAGTCGCTGTTGGATCGGGTTCTAAAGGAAAGGGTGGAGAGATTCAACCAGTTAGCGTGAAAGTTGGAGATAAAGTTCTTCTCCCAGAATATGGAGGCACCAAAGTAGTTCTAGATGACAAGGATTATTTCCTATTTAGAGATGGTGACATTCTTGGAAAGTACGTAGACTGAAATAAGTCACTATTGAAATGGCATCAACATGATGCTGCCCATTCCACTGAAGTTCTGAAATCTTTCGTCATGTAAATAATTTCCATATTTCTCTTTTATAATAAACTAATGATAACTAATGACATCCAGTGTCTCCAAAATTGTTTCCTTGTACTGATATAAACACTTCCAAATAAAAATATGTAAATGA |
PMID - Link | Title |
---|