Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name DYNLT1P2
Plot displaying the genomic locations of a retrocopy (in chr17) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr17:12115525-12116239  UCSC
Coordinates (T2T) chr17:12023538-12024253  UCSC
Coordinates (hg19) chr17:12018842-12019556  UCSC
Strand +
Parental Sequence NM_006519.4
Parental seq. overlap 657 bp
Parental seq. overlap (%) 88.8%
Genomic Region Intragenic (MAP2K4)
Retrocopy Summary DYNLT1P2, located on chr17:12115525-12116239, is a retrocopy of the parental gene DYNLT1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DYNLT1
Full Name dynein light chain Tctex-type 1
Also known as CW-1|TCTEL1|TCTEX1|tctex-1
Coordinate chr6:158636474-158644743
Strand -
Gene summary This gene encodes a component of the motor complex, cytoplasmic dynein, which transports cellular cargo along microtubules in the cell. The encoded protein regulates the length of primary cilia which are sensory organelles found on the surface of cells. The protein encoded by this gene interacts with viral proteins, like the minor capsid protein L2 of human papillomavirus, and is required for dynein-mediated delivery of the viral nucleic acid to the host nucleus. This protein interacts with oncogenic nucleoporins to disrupt gene regulation and cause leukemic transformation. Pseudogenes of this gene are present on chromosomes 4 and 17. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DYNLT1P2
Bonobo Pan paniscus DYNLT1P2
Gorilla Gorilla gorilla DYNLT1P2
Orangutan Pongo abelii DYNLT1P2
Gibbon Nomascus leucogenys DYNLT1P1
Green monkey Chlorocebus sabaeus DYNLT1P1
Crab-eating macaque Macaca fascicularis DYNLT1P2
Rhesus Macaca mulatta DYNLT1P2
Baboon Papio anubis DYNLT1P2
Golden snub-nosed monkey Rhinopithecus roxellana DYNLT1P2
Marmoset Callithrix jacchus DYNLT1P3
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>DYNLT1P2
AGAGGTGACGGGCCGGAGAAAGATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAAATTGTAAAAGAGGCTATAGAAAGCACAATTGGTGGTTAACGCTTATTAACACAGCAAAGTGAACCAGTGGAACACAAATGTAGTAGAACAAACTTCAAGCCAACTCACCAAGCTGGGAAAACCACTTAAATACATTGTGACCTGTGTAATTATGCAAAAGAATGGAGCTGGATTACACATGGCAAGTTCCTGCTTCTGGGACAGCTCTGCTGACAGGAGCTGCACTGTGCGATGGGAGAATAAAACCATGTACTGCATCGTCGGCACCTTTGGACTGTGTATTGGACCTCCTAGTCCAGCCTGTGACCTTCCTCCGGTAGTTCATCTTCTAACACCAGCTATGAATTGAGTGAACTCTTTTCTCGTTCTTTTTAAGTCTGTTTTGTGGCACTCTAAAAATGCAGAGAAAAAAACCAAATGACCGCACTGTTACATGAACTGTGCACTGAAGTCAGATGAGTATCCCTGTAGGTCGCCTGCAGCCTGCATTGCCACTTGTAACTCTGAATATTTCTTTTCAAAGGTGCTAAAATCTGAAATCTGCTGGTGTGAAACTTGCTATACTGTCTGAAATGATTCAAATACACTAATTTTCCATACTTTATACTTTTGTTAGAATAAATTATTCAAATCTAA
>NM_006519.4
ACTCAGGGAGCCGGAGGGGACGCGCCGGAGGAAAGATGGAAGACTACCAGGCTGCGGAGGAGACTGCTTTTGTTGTTGATGAAGTGAGCAACATTGTAAAAGAGGCTATAGAAAGCGCAATTGGTGGTAACGCTTATCAACACAGCAAAGTGAACCAGTGGACCACAAATGTAGTAGAACAAACTTTAAGCCAACTCACCAAGCTGGGAAAACCATTTAAATACATCGTGACCTGTGTAATTATGCAGAAGAATGGAGCTGGATTACACACAGCAAGTTCCTGCTTCTGGGACAGCTCTACTGACGGGAGCTGCACTGTGCGATGGGAGAATAAGACCATGTACTGCATCGTCAGTGCCTTCGGACTGTCTATTTGACCTGCAGTCCAGCCTATGGCCTTTCTCCTTTTGTCTCTAGTTCATCCTCTAACCACCAGCCATGAATTCAGTGAACTCTTTTCTCATTCTCTTTGTTTTGTGGCACTTTCACAATGTAGAGGAAAAAACCAAATGACCGCACTGTGATGTGAATGGCACCGAAGTCAGATGAGTATCCCTGTAGGTCACCTGCAGCCTGCGTTGCCACTTGTCTTAACTCTGAATATTTCATTTCAAAGGTGCTAAAATCTGAAATCTGCTAGTGTGAAACTTGCTCTACTCTCTGAAATGATTCAAATACACTAATTTTCCATACTTTATACTTTTGTTAGAATAAATTATTCAAATCTAAA

Publications

PMID - Link Title