Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFA12P4
Plot displaying the genomic locations of a retrocopy (in chr17) and its respective parental gene (in chr12). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr17:35806926-35807099  UCSC
Coordinates (T2T) chr17:36754837-36755010  UCSC
Coordinates (hg19) chr17:34133930-34134103  UCSC
Strand +
Parental Sequence NM_001258338.2
Parental seq. overlap 144 bp
Parental seq. overlap (%) 30.4%
Genomic Region Intergenic
Retrocopy Summary NDUFA12P4, located on chr17:35806926-35807099, is a retrocopy of the parental gene NDUFA12. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFA12
Full Name NADH:ubiquinone oxidoreductase subunit A12
Also known as B17.2|DAP13|MC1DN23
Coordinate chr12:94971333-95003697
Strand -
Gene summary This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFA12P4
Bonobo Pan paniscus NDUFA12P4
Gorilla Gorilla gorilla NDUFA12P2
Green monkey Chlorocebus sabaeus NDUFA12P3
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFA12P4
ACAAGATAGAGTTAGTGCAGGTCCTGATGCACGGGTGGCAGCAGGTCAGCAGACACGCAGCCTCTGAGACTATCTACAGAATTTTATCAGGACAAATGGTGTGAGGGTTGGTACATTAGTAGGGGAAGACAAATACAGAAACAAATAGTATGAAGACAACAAGAAACTTTTT
>NM_001258338.2
GGGGCCAGCGAGGCAAGATGGAGTTAGTGCAGGTCCTGAAACGCGGGCTGCAGCAGATCACCGGCCACGGCGGTCTCCGAGGCTATCTACGGGTTTTTTTCAGGACAAATGATGCGAAGGTTGGTACATTAGTGGGGGAAGACAAATATGGAAACAAATACTATGAAGACAACAAGCAATTTTTTGGCATCGTTGGCTTCACAGTATGACTGATGATCCTCCAACAACAAAACCACTTACTGCTCGTAAATTCATTTGGACGAACCATAAATTCAACGTGACTGGCACCCCAGAACAATATGTACCTTATTCTACCACTAGAAAGAAGATTCAGGAGTGGATCCCACCTTCAACACCTTACAAGTAAAGACAATGAAGAACAGTTGAAACATGCAAAATATGGAGCTTTTCATGTAATTACTCTTTTACTGTTTACCATTCACTATAATTCACAATTAAAATTGTGTGACTAAA

Publications

PMID - Link Title