Summary

Retrocopy Name	VAMP5P1
Species	Homo sapiens
Coordinates (hg38)	chr17:46717766-46718325  UCSC
Coordinates (T2T)	chr17:47579248-47579807  UCSC
Coordinates (hg19)	chr17:44795132-44795691  UCSC
Strand	+
Parental Sequence	NM_006634.3
Parental seq. overlap	473 bp
Parental seq. overlap (%)	71.7%
Genomic Region	Intragenic (LRRC37A2) Intragenic (NSF)
Retrocopy Summary	VAMP5P1, located on chr17:46717766-46718325, is a retrocopy of the parental gene VAMP5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name	VAMP5
Full Name	vesicle associated membrane protein 5
Also known as	-
Coordinate	chr2:85584431-85593406
Strand	+
Gene summary	Synaptobrevins/VAMPs, syntaxins, and the 25-kD synaptosomal-associated protein are the main components of a protein complex involved in the docking and/or fusion of vesicles and cell membranes. The VAMP5 gene is a member of the vesicle-associated membrane protein (VAMP)/synaptobrevin family and the SNARE superfamily. This VAMP family member may participate in vesicle trafficking events that are associated with myogenesis. [provided by RefSeq, Jul 2008]

Homology

	Species	Scientific Name	Retrocopy
	Chimpanzee	Pan troglodytes	VAMP5P1
	Bonobo	Pan paniscus	VAMP5P1
	Gorilla	Gorilla gorilla	VAMP5P1
	Orangutan	Pongo abelii	VAMP5P1
	Gibbon	Nomascus leucogenys	VAMP5P1
	Green monkey	Chlorocebus sabaeus	VAMP5P1
	Crab-eating macaque	Macaca fascicularis	VAMP5P1
	Rhesus	Macaca mulatta	VAMP5P1
	Baboon	Papio anubis	VAMP5P1
	Golden snub-nosed monkey	Rhinopithecus roxellana	VAMP5P1
	Marmoset	Callithrix jacchus	VAMP5P1
	Mouse lemur	Microcebus murinus	Without Homology
	Mouse	Mus musculus	Without Homology
	Rat	Rattus norvegicus	Without Homology
	Chinese hamster	Cricetulus griseus	Without Homology
	Rabbit	Oryctolagus cuniculus	Without Homology
	Pig	Sus scrofa	Without Homology
	Cow	Bos taurus	Without Homology
	Sheep	Ovis aries	Without Homology
	Dolphin	Tursiops truncatus	Without Homology
	Horse	Equus caballus	Without Homology
	Dog	Canis familiaris	Without Homology
	Panda	Ailuropoda melanoleuca	Without Homology
	Cat	Felis catus	Without Homology
	Pale spear-nosed bat	Phyllostomus discolor	Without Homology
	Velvety free-tailed bat	Molossus molossus	Without Homology
	Greater mouse-eared bat	Myotis myotis	Without Homology
	Kuhl's pipistrelle	Pipistrellus kuhlii	Without Homology
	Greater horseshoe bat	Rhinolophus ferrumequinum	Without Homology
	Egyptian rousette	Rousettus aegyptiacus	Without Homology
	Sloth	Choloepus didactylus	Without Homology
	Tasmanian Devil	Sarcophilus harrisii	Without Homology
	Opossum	Monodelphis domestica	Without Homology
	Platypus	Ornithorhynchus anatinus	Without Homology
	Chicken	Gallus gallus	Without Homology
	Turkey	Meleagris gallopavo	Without Homology
	Zebra Finch	Taeniopygia guttata	Without Homology
	Budgerigar	Melopsittacus undulatus	Without Homology
	Painted Turtle	Chrysemys picta	Without Homology
	Lizard	Anolis Carolinensis	Without Homology
	Frog	Xenopus tropicalis	Without Homology
	Zebrafish	Danio rerio	Without Homology
	Drosophila	Drosophila melanogaster	Without Homology

Expression

This retrocopy transcript is not present in the GTEx database for expression quantification.

This retrocopy transcript is not present in the ARCHS4 database for expression quantification

Related Sequence

>VAMP5P1

aAGCGAACAAGGTGACGGAAATCACGCTTAACAACTTTGACAAGGTCCTGGAGCATGATGGAAAGCTGACCGAACTGGAGCAGCGTTCAGACCAACTCCTGGATATGAGCTCAGCCTTCAGCAAGACAACAAAGACCCTGGCCCAGAAGAAGTGCTGGGAGAACATCCATTGCCAGATCTACTTGGGGCTAGTGGTGGGTGGTAGCCTGCTCATCATCCTGATTGAGCAGCTGGCCATCTTTCTCCCTCAGAGTGACACCAGTAATGCCCCACAGACCTAGGATGCAGGCACCACCTCAGGGCCTGGGGACTGACAGCTGGTCCTGAGGGAGAAGCCAAATGGCTGCACTGGCTGGTTCCGGTCTCCAGAGAACCTTGGTGTTTGCTCTCCCCTGACCCACCCCAGTGAGTGCCAAAGGGCAGCCCCAACACGTGCACCCCTGCATTTCTTGTCATGCCACAGACTGGCCCTCGAGGGCACCCTGCCATACTGGCCATGCCGGGCCAGCCCCACCTGAAGCTCAGT

>NM_006634.3

ACTGCGGCCGCTCCGCAGGCAGAGAAGCCGGGAGCGGGCGAGGCGGCGGCGGCAGCAGCGATGGCAGGAATAGAGTTGGAGCGGTGCCAGCAGCAGGCGAACGAGGTGACGGAAATTATGCGTAACAACTTCGGCAAGGTCCTGGAGCGTGGTGTGAAGCTGGCCGAACTGCAGCAGCGTTCAGACCAACTCCTGGATATGAGCTCAACCTTCAACAAGACTACACAGAACCTGGCCCAGAAGAAGTGCTGGGAGAACATCCGTTACCGGATCTGCGTGGGGCTGGTGGTGGTTGGTGTCCTGCTCATCATCCTGATTGTGCTGCTGGTCGTCTTTCTCCCTCAGAGCAGTGACAGCAGTAGTGCCCCACGGACCCAGGATGCAGGCATTGCCTCAGGGCCTGGGAACTGACCCAGCTGGTCCTGAAGGAGAAGCCAAATGGCTGCACTGGCCGATTCTGGTCTCCAGAGGACCTTGGTGTTTGCTCTCCCTTGACCCACCCCAGTGAGTGCCAAAGGGCAGCCCCAACATGTGCACCCCTGCATTTCCTGTCATGCCACAGACTGGCCCTTGAGGGCAGCCTGCTGTACTGGCCATGCTGGGCCAGCCCCACCTGGAGCTCAGTAAAAACTGCTGTTTGATTAAAAGCTGGTATCTGTG

Publications

PMID - Link	Title
No publications available for this retrocopy