Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name TMSB4XP11
Wait
Plot displaying the genomic locations of a retrocopy (in chr18) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr18:26130285-26130554  UCSC
Coordinates (T2T) chr18:26324935-26325204  UCSC
Coordinates (hg19) chr18:23710249-23710518  UCSC
Strand -
Parental Sequence NM_021109.4
Parental seq. overlap 224 bp
Parental seq. overlap (%) 36%
Genomic Region Intergenic
Retrocopy Summary TMSB4XP11, located on chr18:26130285-26130554, is a retrocopy of the parental gene TMSB4X. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name TMSB4X
Full Name thymosin beta 4 X-linked
Also known as FX|PTMB4|TB4X|TMSB4
Coordinate chrX:12975110-12977223
Strand +
Gene summary This gene encodes an actin sequestering protein which plays a role in regulation of actin polymerization. The protein is also involved in cell proliferation, migration, and differentiation. This gene escapes X inactivation and has a homolog on chromosome Y. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes TMSB4XP8
Bonobo Pan paniscus TMSB4XP8
Gorilla Gorilla gorilla TMSB4XP7
Orangutan Pongo abelii TMSB4XP8
Gibbon Nomascus leucogenys TMSB4XP1
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the ARCHS4 database for expression quantificationThis retrocopy transcript is not present in the GTEx database for expression quantification.

Related Sequence

>TMSB4XP11
TGACAAACCCAGTATGGCTGAGATTGATAAATTCAGTAAGTAAAAATTGAAGAGAACAAAAACAAGACTAAAATCCACTGCCTTCCAAAGAAATGATTATACAGGAGAGACAATTATGCAAATAGTAATGAGGACTGTGCTGCCAATATACGCTACATCCCACAAGCATTGCCTTCTTATTTTACTCCTTTTAGCTGTTTTATTTTATAAGATGCAGAGAAGTGGGATTGAGTTTAAATGACTGTGCTACTACTCTTCACATCAAAGAAT
>NM_021109.4
AACTCGGTGGTGGCCACTGCGCAGACCAGACTTCGCTCGTACTCGTGCGCCTCGCTTCGCTTTTCCTCCGCAACCATGTCTGACAAACCCGATATGGCTGAGATCGAGAAATTCGATAAGTCGAAACTGAAGAAGACAGAGACGCAAGAGAAAAATCCACTGCCTTCCAAAGAAACGATTGAACAGGAGAAGCAAGCAGGCGAATCGTAATGAGGCGTGCGCCGCCAATATGCACTGTACATTCCACAAGCATTGCCTTCTTATTTTACTTCTTTTAGCTGTTTAACTTTGTAAGATGCAAAGAGGTTGGATCAAGTTTAAATGACTGTGCTGCCCCTTTCACATCAAAGAACTACTGACAACGAAGGCCGCGCCTGCCTTTCCCATCTGTCTATCTATCTGGCTGGCAGGGAAGGAAAGAACTTGCATGTTGGTGAAGGAAGAAGTGGGGTGGAAGAAGTGGGGTGGGACGACAGTGAAATCTAGAGTAAAACCAAGCTGGCCCAAGGTGTCCTGCAGGCTGTAATGCAGTTTAATCAGAGTGCCATTTTTTTTTTTGTTCAAATGATTTTAATTATTGGAATGCACAATTTTTTTAATATGCAAATAAAAAGTTTAAAAA

Publications

PMID - Link Title
No publications available for this retrocopy