| Retrocopy Name | DYNLRB1P2 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr18:60495814-60496078 UCSC | |
| Coordinates (T2T) | chr18:60698793-60699057 UCSC | |
| Coordinates (hg19) | chr18:58163047-58163311 UCSC | |
| Strand | - | |
| Parental Sequence | NM_014183.4 | |
| Parental seq. overlap | 228 bp | |
| Parental seq. overlap (%) | 34.4% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | DYNLRB1P2, located on chr18:60495814-60496078, is a retrocopy of the parental gene DYNLRB1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | DYNLRB1 |
| Full Name | dynein light chain roadblock-type 1 |
| Also known as | BITH|BLP|DNCL2A|DNLC2A|ROBLD1 |
| Coordinate | chr20:34515602-34540958 |
| Strand | + |
| Gene summary | This gene is a member of the roadblock dynein light chain family. The encoded cytoplasmic protein is capable of binding intermediate chain proteins, interacts with transforming growth factor-beta, and has been implicated in the regulation of actin modulating proteins. Upregulation of this gene has been associated with hepatocellular carcinomas, suggesting that this gene may be involved in tumor progression. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 12 and 18. [provided by RefSeq, Aug 2013] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | DYNLRB1P2 |
![]() |
Bonobo | Pan paniscus | DYNLRB1P2 |
![]() |
Orangutan | Pongo abelii | DYNLRB1P2 |
![]() |
Gibbon | Nomascus leucogenys | DYNLRB1P1 |
![]() |
Green monkey | Chlorocebus sabaeus | DYNLRB1P2 |
![]() |
Crab-eating macaque | Macaca fascicularis | DYNLRB1P2 |
![]() |
Rhesus | Macaca mulatta | DYNLRB1P2 |
![]() |
Baboon | Papio anubis | DYNLRB1P2 |
![]() |
Gorilla | Gorilla gorilla | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >DYNLRB1P2 |
| AAGGTATTCCCATCAAAAGTACCGTGGGCAATCCCACCACCACACAGTATGCCAGCCTCACGCACAACTTCACCTGGAAGGCACAGAGTACCATGAATGAAATCGATCCCTAGAATGACCTTACCTTCCTTCAAATCCGCTCCATGAAGAATGAAACTATGGTTGCACCAGATAAAGACTATCTCCTGATTGTGATTCAGAATCCAAGGGAATAAATCACTCTTTTGGCCCTTGTATCATTCATTAATTTAATGCCCTCCAAGAT |
| >NM_014183.4 |
| AAGTGTTCGCTACGCGGGGCTACCGGATCGGTCGGAAATGGCAGAGGTGGAGGAGACACTGAAGCGACTGCAGAGCCAGAAGGGAGTGCAGGGAATCATCGTCGTGAACACAGAAGGCATTCCCATCAAGAGCACCATGGACAACCCCACCACCACCCAGTATGCCAGCCTCATGCACAGCTTCATCCTGAAGGCACGGAGCACCGTGCGTGACATCGACCCCCAGAACGATCTCACCTTCCTTCGAATTCGCTCCAAGAAAAATGAAATTATGGTTGCACCAGATAAAGACTATTTCCTGATTGTGATTCAGAATCCAACCGAATAAGCCACTCTCTTGGCTCCCTGTGTCATTCCTTAATTTAATGCCCCCCAAGAATGTTAATGTCAATCATGTCAGTGGACTAGCACATGGCAGTCGCTTGGAACCCACTCACACCAATCCAGTGACCGTGTGTGGGCTGGCGGCTCTTCTCCCCCACCAACGGAACCCCTGTGTGCACCAACCTTCCCCAGAGCTCCGGAGCGCCCTCTCCTCACTTCCAGGTTTTGGAGCAAGAGCTTGCAGGAAGCCCGCACCCAGCTTCCTTCTGACCTTCAGTTCACTTTGTCGCCCTTGGAGAAAGCTGTTTTTCTTTAACTAAAAATAACCAAAATGCTTA |
| PMID - Link | Title |
|---|