Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name DYNLRB1P2
Plot displaying the genomic locations of a retrocopy (in chr18) and its respective parental gene (in chr20). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr18:60495814-60496078  UCSC
Coordinates (T2T) chr18:60698793-60699057  UCSC
Coordinates (hg19) chr18:58163047-58163311  UCSC
Strand -
Parental Sequence NM_014183.4
Parental seq. overlap 228 bp
Parental seq. overlap (%) 34.4%
Genomic Region Intergenic
Retrocopy Summary DYNLRB1P2, located on chr18:60495814-60496078, is a retrocopy of the parental gene DYNLRB1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DYNLRB1
Full Name dynein light chain roadblock-type 1
Also known as BITH|BLP|DNCL2A|DNLC2A|ROBLD1
Coordinate chr20:34515602-34540958
Strand +
Gene summary This gene is a member of the roadblock dynein light chain family. The encoded cytoplasmic protein is capable of binding intermediate chain proteins, interacts with transforming growth factor-beta, and has been implicated in the regulation of actin modulating proteins. Upregulation of this gene has been associated with hepatocellular carcinomas, suggesting that this gene may be involved in tumor progression. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 12 and 18. [provided by RefSeq, Aug 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DYNLRB1P2
Bonobo Pan paniscus DYNLRB1P2
Orangutan Pongo abelii DYNLRB1P2
Gibbon Nomascus leucogenys DYNLRB1P1
Green monkey Chlorocebus sabaeus DYNLRB1P2
Crab-eating macaque Macaca fascicularis DYNLRB1P2
Rhesus Macaca mulatta DYNLRB1P2
Baboon Papio anubis DYNLRB1P2
Gorilla Gorilla gorilla Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>DYNLRB1P2
AAGGTATTCCCATCAAAAGTACCGTGGGCAATCCCACCACCACACAGTATGCCAGCCTCACGCACAACTTCACCTGGAAGGCACAGAGTACCATGAATGAAATCGATCCCTAGAATGACCTTACCTTCCTTCAAATCCGCTCCATGAAGAATGAAACTATGGTTGCACCAGATAAAGACTATCTCCTGATTGTGATTCAGAATCCAAGGGAATAAATCACTCTTTTGGCCCTTGTATCATTCATTAATTTAATGCCCTCCAAGAT
>NM_014183.4
AAGTGTTCGCTACGCGGGGCTACCGGATCGGTCGGAAATGGCAGAGGTGGAGGAGACACTGAAGCGACTGCAGAGCCAGAAGGGAGTGCAGGGAATCATCGTCGTGAACACAGAAGGCATTCCCATCAAGAGCACCATGGACAACCCCACCACCACCCAGTATGCCAGCCTCATGCACAGCTTCATCCTGAAGGCACGGAGCACCGTGCGTGACATCGACCCCCAGAACGATCTCACCTTCCTTCGAATTCGCTCCAAGAAAAATGAAATTATGGTTGCACCAGATAAAGACTATTTCCTGATTGTGATTCAGAATCCAACCGAATAAGCCACTCTCTTGGCTCCCTGTGTCATTCCTTAATTTAATGCCCCCCAAGAATGTTAATGTCAATCATGTCAGTGGACTAGCACATGGCAGTCGCTTGGAACCCACTCACACCAATCCAGTGACCGTGTGTGGGCTGGCGGCTCTTCTCCCCCACCAACGGAACCCCTGTGTGCACCAACCTTCCCCAGAGCTCCGGAGCGCCCTCTCCTCACTTCCAGGTTTTGGAGCAAGAGCTTGCAGGAAGCCCGCACCCAGCTTCCTTCTGACCTTCAGTTCACTTTGTCGCCCTTGGAGAAAGCTGTTTTTCTTTAACTAAAAATAACCAAAATGCTTA

Publications

PMID - Link Title