Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name ATP5MC1P6
Plot displaying the genomic locations of a retrocopy (in chr18) and its respective parental gene (in chr17). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr18:63496955-63497498  UCSC
Coordinates (T2T) chr18:63702027-63702570  UCSC
Coordinates (hg19) chr18:61164188-61164731  UCSC
Strand +
Parental Sequence NM_001002027.2
Parental seq. overlap 496 bp
Parental seq. overlap (%) 85.4%
Genomic Region Intragenic (SERPINB5)
Retrocopy Summary ATP5MC1P6, located on chr18:63496955-63497498, is a retrocopy of the parental gene ATP5MC1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name ATP5MC1
Full Name ATP synthase membrane subunit c locus 1
Also known as ATP5A|ATP5G|ATP5G1
Coordinate chr17:48892787-48895871
Strand +
Gene summary This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene is one of three genes that encode subunit c of the proton channel. Each of the three genes have distinct mitochondrial import sequences but encode the identical mature protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes ATP5MC1P8
Bonobo Pan paniscus ATP5MC1P8
Gorilla Gorilla gorilla ATP5MC1P8
Orangutan Pongo abelii ATP5MC1P10
Gibbon Nomascus leucogenys ATP5MC1P1
Green monkey Chlorocebus sabaeus ATP5G1P11
Crab-eating macaque Macaca fascicularis ATP5G1P11
Rhesus Macaca mulatta ATP5MC1P12
Baboon Papio anubis ATP5MC1P11
Golden snub-nosed monkey Rhinopithecus roxellana ATP5MC1P12
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>ATP5MC1P6
AGAGACCAAGGGCTAAAGTTGGGAGACTGAGAAAATGCAGCCCACCGGGGCATTACTTATTTCTCCAGCTCTGATCCGCTGTTGTACTAGGGGTCTAATCCGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGAGCATTCATCTAAACAGCCTTCCTACAGCAGCTCCCCACTTTAGGTGTGGCCAGACAGGAGTTCTAGACCAGGTTGTCTCCTGGGACATTGACACCGCAGCCAAGTTTATTGGTGCTGAGGCAGACACAGTTGGTGTGGTTGGTTCAGGGGCTAGCATTGGAATAGCGTTTGGCAGCTTGATCATTGGTTATTCCAGGAACCCATCTCTCAAGCAGCAGCTCTTCTCCTATGCGATTCTGGGCTTTGCCCTGTCTGAGGCCATGGGGCTCTTCTGTTTGATGGTCGCCTTCCTTATCCTCTTCGCCATGTGAAGCTCTGTGGGGGTCACCTGCCTGTCCCTGCTGCTGCGGCTGCACACCATTCTTGGTGCTGGGCTGTGCTAAGCTTTACCATTGAACACAACGTTTCT
>NM_001002027.2
AGGACACGTGGGTGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAGACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATCAGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTACAGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGACATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCAGGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCTCTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGGCTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGGTCACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTTACCATTAAACACAACGTTTCTCTAAA

Publications

PMID - Link Title