Retrocopy Name | CELA1P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr19:32962782-32962934 UCSC | |
Coordinates (T2T) | chr19:35481470-35481622 UCSC | |
Coordinates (hg19) | chr19:33453688-33453840 UCSC | |
Strand | + | |
Parental Sequence | NM_001971.6 | |
Parental seq. overlap | 138 bp | |
Parental seq. overlap (%) | 14.5% | |
Genomic Region |
Intragenic (CEP89) |
|
Retrocopy Summary | CELA1P1, located on chr19:32962782-32962934, is a retrocopy of the parental gene CELA1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | CELA1 |
Full Name | chymotrypsin like elastase 1 |
Also known as | ELA1 |
Coordinate | chr12:51328442-51346679 |
Strand | - |
Gene summary | Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode the structurally similar proteins elastase 1, 2, 2A, 2B, 3A, and 3B. Unlike other elastases, pancreatic elastase 1 is not expressed in the pancreas. To date, elastase 1 expression has only been detected in skin keratinocytes. Clinical literature that describes human elastase 1 activity in the pancreas or fecal material is actually referring to chymotrypsin-like elastase family, member 3B. [provided by RefSeq, May 2009] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | CELA1P1 |
![]() |
Bonobo | Pan paniscus | CELA1P1 |
![]() |
Gorilla | Gorilla gorilla | CELA1P1 |
![]() |
Orangutan | Pongo abelii | CELA1P1 |
![]() |
Gibbon | Nomascus leucogenys | CELA1P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | CELA1P1 |
![]() |
Rhesus | Macaca mulatta | CELA1P1 |
![]() |
Baboon | Papio anubis | CELA1P1 |
![]() |
Dolphin | Tursiops truncatus | RPL31P27 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>CELA1P1 |
AAGCCAGGGCTGTGATGTCTCCAGGAAACCCACAGTCTTCACCCAGGTCTCTGCTTACGTCTCCTGGATGAAAAATGTCATTGCCTCCAACTGAACATGATCCTGAGTCCAACGGCCTTCCCAAGATGGTTCTTAGATCTGCAACAGGACTTG |
>NM_001971.6 |
TTGGTCCAAGCAAGAAGGCAGTGGTCTACTCCATCGGCAACATGCTGGTCCTTTATGGACACAGCACCCAGGACCTTCCGGAAACCAATGCCCGCGTAGTCGGAGGGACTGAGGCCGGGAGGAATTCCTGGCCCTCTCAGATTTCCCTCCAGTACCGGTCTGGAGGTTCCCGGTATCACACCTGTGGAGGGACCCTTATCAGACAGAACTGGGTGATGACAGCTGCTCACTGCGTGGATTACCAGAAGACTTTCCGCGTGGTGGCTGGAGACCATAACCTGAGCCAGAATGATGGCACTGAGCAGTACGTGAGTGTGCAGAAGATCGTGGTGCATCCATACTGGAACAGCGATAACGTGGCTGCCGGCTATGACATCGCCCTGCTGCGCCTGGCCCAGAGCGTTACCCTCAATAGCTATGTCCAGCTGGGTGTTCTGCCCCAGGAGGGAGCCATCCTGGCTAACAACAGTCCCTGCTACATCACAGGCTGGGGCAAGACCAAGACCAATGGGCAGCTGGCCCAGACCCTGCAGCAGGCTTACCTGCCCTCTGTGGACTACGCCATCTGCTCCAGCTCCTCCTACTGGGGCTCCACTGTGAAGAACACCATGGTGTGTGCTGGTGGAGATGGAGTTCGCTCTGGATGCCAGGGTGACTCTGGGGGCCCCCTCCATTGCTTGGTGAATGGCAAGTATTCTGTCCATGGAGTGACCAGCTTTGTGTCCAGCCGGGGCTGTAATGTCTCCAGGAAGCCTACAGTCTTCACCCAGGTCTCTGCTTACATCTCCTGGATAAATAATGTCATCGCCTCCAACTGAACATTTTCCTGAGTCCAACGACCTTCCCAAAATGGTTCTTAGATCTGCAGTAGGACTTGCGATCAAAAAGTAAAACACATTCTGAAAGACTATTGAGCCATTGATAGAAAAGCAAATAAAACTAGATATACATTA |
PMID - Link | Title |
---|