Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name KIR2DL1P1
Plot displaying the genomic locations of a retrocopy (in chr19) and its respective parental gene (in chr19_GL000209v2_alt). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr19:54735968-54736535  UCSC
Coordinates (hg19) chr19:55247435-55248002  UCSC
Strand +
Parental Sequence NM_014218.3_23
Parental seq. overlap 398 bp
Parental seq. overlap (%) 24.6%
Genomic Region Intragenic (KIR3DL3)
Retrocopy Summary KIR2DL1P1, located on chr19:54735968-54736535, is a retrocopy of the parental gene KIR2DS2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name KIR2DS2
Full Name killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 2
Also known as 183ActI|CD158J|CD158b|KIR-2DS2|KIR2DL1|NKAT-5|NKAT5|cl-49
Coordinate chr19_GL000209v2_alt:122955-137265
Strand -
Gene summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene represents a haplotype-specific family member that encodes a protein with a short cytoplasmic tail. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>KIR2DL1P1
CAGGACTCTGATGAACAAGACCCTCAGGAGGTGACATACGCACAGTTGAATCACTGCGTTTTCACACAGAGAAAAATCACTCGCCCTTCTCAGAGGCCCAAGACACCCCCAACAGATACCAGCGTGTAACACGGAACTTCCAAATGCTGAGCGCAGATCCAAAGTTGTCTTCTGTCCACTAGCACCACAGTCAGGCCTTGATGGGATCTTCTAGGGAGACAATAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGACTCTGAAGGCGTGAGTCTGCATCTTAGGGCATCGCTCTTCCTCACACCACGAATCTGAACATGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACACACTTGCTTAGCCCACAATTCTCCATTTC
>NM_014218.3_23
ATCCTGTGCGCTGCTGAGCTGAGCTCGGTCGCGGCTGCCTGTCTGCTCCGGCAGCACCATGTCGCTCTTGGTCGTCAGCATGGCGTGTGTTGGGTTCTTCTTGCTGCAGGGGGCCTGGCCACATGAGGGAGTCCACAGAAAACCTTCCCTCCTGGCCCACCCAGGTCGCCTGGTGAAATCAGAAGAGACAGTCATCCTGCAATGTTGGTCAGATGTCATGTTTGAACACTTCCTTCTGCACAGAGAGGGGATGTTTAACGACACTTTGCGCCTCATTGGAGAACACCATGATGGGGTCTCCAAGGCCAACTTCTCCATCAGTCGCATGAAGCAAGACCTGGCAGGGACCTACAGATGCTACGGTTCTGTTACTCACTCCCCCTATCAGTTGTCAGCTCCCAGTGACCCTCTGGACATCGTGATCATAGGTCTATATGAGAAACCTTCTCTCTCAGCCCAGCCGGGCCCCACGGTTCTGGCAGGAGAGAATGTGACCTTGTCCTGCAGCTCCCGGAGCTCCTATGACATGTACCATCTATCCAGGGAAGGGGAGGCCCATGAACGTAGGCTCCCTGCAGGGACCAAGGTCAACGGAACATTCCAGGCCAACTTTCCTCTGGGCCCTGCCACCCATGGAGGGACCTACAGATGCTTCGGCTCTTTCCGTGACTCTCCATACGAGTGGTCAAAGTCAAGTGACCCACTGCTTGTTTCTGTCACAGGAAACCCTTCAAATAGTTGGCCTTCACCCACTGAACCAAGCTCCGAAACCGGTAACCCCAGACACCTACATGTTCTGATTGGGACCTCAGTGGTCAAAATCCCTTTCACCATCCTCCTCTTCTTTCTCCTTCATCGCTGGTGCTCCGACAAAAAAAATGCTGCTGTAATGGACCAAGAGCCTGCAGGGAACAGAACAGTGAACAGCGAGGATTCTGATGAACAAGACCATCAGGAGGTGTCATACGCATAATTGGATCACTGTGTTTTCACACAGAGAAAAATCACTCGCCCTTCTGAGAGGCCCAAGACACCCCCAACAGATACCAGCATGTACATAGAACTTCCAAATGCTGAGCCCAGATCCAAAGTTGTCTTCTGTCCACGAGCACCACAGTCAGGCCTTGAGGGGATCTTCTAGGGAGACAACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCATCAGTCTTCATCTTAGGGCATCGCTCTTCCTCACACCACGAATCTGAACATGCCTCTCTCTTGCTTACAAATGTCTAAGGTCCCCACTGCCTGCTGGAGAGAAAACACACTCCTTTGCTTAGCCCACAATTCTCCATTTCacttgacccctgcccacctctccaacctaactggcttacttcctagtctacctgaggctgcaatcacactgaggaactcacaattccaaacatacaagaggctgcctcttaacacagcacttagacacgtgctgttccaccttccctcatgctgttccacctcccctcAGACTATCTTTCAGCCTTCTGTCATCAGTAAAATTTATAAATTTTTTTTATAACTTCAGTGTAGCTCTCTCCTCTTCAAATAAACATGTCTGCCCTCA

Publications

PMID - Link Title