Retrocopy Name | RPL26P38 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr1:9662304-9662670 UCSC | |
Coordinates (T2T) | chr1:9205076-9205442 UCSC | |
Coordinates (hg19) | chr1:9722362-9722728 UCSC | |
Strand | - | |
Parental Sequence | NM_000987.5 | |
Parental seq. overlap | 311 bp | |
Parental seq. overlap (%) | 58.3% | |
Genomic Region |
Intragenic (CLSTN1) Intragenic (PIK3CD) |
|
Retrocopy Summary | RPL26P38, located on chr1:9662304-9662670, is a retrocopy of the parental gene RPL26. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | RPL26 |
Full Name | ribosomal protein L26 |
Also known as | DBA11|L26 |
Coordinate | chr17:8377516-8383193 |
Strand | - |
Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L24P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | RPL26P5 |
![]() |
Bonobo | Pan paniscus | RPL26P5 |
![]() |
Gorilla | Gorilla gorilla | RPL26P5 |
![]() |
Orangutan | Pongo abelii | RPL26P4 |
![]() |
Gibbon | Nomascus leucogenys | RPL26P26 |
![]() |
Green monkey | Chlorocebus sabaeus | RPL26P22 |
![]() |
Crab-eating macaque | Macaca fascicularis | RPL26P4 |
![]() |
Rhesus | Macaca mulatta | RPL26P4 |
![]() |
Baboon | Papio anubis | RPL26P6 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | RPL26P35 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>RPL26P38 |
CTCTTCACTTTTGTGGCCATCACCGAAGCCGGAGTGGCCAAAATGAAGTTCAATACCTTCGTGACTTAGAACCACAGCAAGAACCACAAAAGGCATTTCTATGCACCTTCCCATATTCGCAGGAAGAGAGATTGTCTTTCCCTCTTTCCAAAGAGCTGAGGCAGAAGCCTAAGTTCAGGTTGTGTGAGGACACCACAGAGGCCAGCAAACCAGCAAAGCGGGTCCAGGTTTAAAGGAAGAAATACGTCATCTACACTGAACGAGTGCAGGGGGAAAAGTCTAATGGCACGACTGTCCACGCTGGCATTCATCCCAGCCAGGCTGTTATCATTAGGCTAACACTGGACAATGACCACAAAAAGATCCG |
>NM_000987.5 |
CTCTTCCCTTTTGCGGCCATCACCGAAGCGGGAGCGGCCAAAATGAAGTTTAATCCCTTTGTGACTTCCGACCGAAGCAAGAATCGCAAAAGGCATTTCAATGCACCTTCCCACATTCGAAGGAAGATTATGTCTTCCCCTCTTTCCAAAGAGCTGAGACAGAAGTACAACGTGCGATCCATGCCCATCCGAAAGGATGATGAAGTTCAGGTTGTACGTGGACACTATAAAGGTCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATATGTTATCTACATTGAACGGGTGCAGCGGGAAAAGGCTAATGGCACAACTGTCCACGTAGGCATTCACCCCAGCAAGGTGGTTATCACTAGGCTAAAACTGGACAAAGACCGCAAAAAGATCCTCGAACGGAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATACAAGGAAGAAACCATTGAGAAGATGCAGGAATAAAGTAATCTTATATACAAGCTTTGATTAAAACTTGAAACAAAGAGCCTG |
PMID - Link | Title |
---|