Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name MT1P3
Plot displaying the genomic locations of a retrocopy (in chr20) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr20:35217938-35218326  UCSC
Coordinates (T2T) chr20:36938713-36939101  UCSC
Coordinates (hg19) chr20:33805741-33806129  UCSC
Strand +
Parental Sequence NM_176870.3
Parental seq. overlap 362 bp
Parental seq. overlap (%) 90.3%
Genomic Region Intragenic (MMP24-AS1-EDEM2)
Retrocopy Summary MT1P3, located on chr20:35217938-35218326, is a retrocopy of the parental gene MT1M. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name MT1M
Full Name metallothionein 1M
Also known as MT-1M|MT-IM|MT1|MT1K
Coordinate chr16:56632659-56633981
Strand +
Gene summary This gene encodes a member of the metallothionein superfamily, type 1 family. Metallothioneins have a high content of cysteine residues that bind various heavy metals. These genes are transcriptionally regulated by both heavy metals and glucocorticoids. [provided by RefSeq, Oct 2011]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes MT1MP2
Bonobo Pan paniscus LOC100989170P1
Gorilla Gorilla gorilla LOC109023582P2
Orangutan Pongo abelii LOC100434163P1
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>MT1P3
ACACGCCGTCCACGTGCGCCTTGCTGTCTCTCCATTATCGCTTGAGATCTCCAGCCTTACCGCGGCTTGAAATGGACCCCAACTGCTCCTGCACCACTGGTGGCTCCTGCACGTGCGCCGGCTCCTGCAAGTGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCCATGGGCTGTGCCAAGTGTGCCCAGGGCTGTGTCTGCAAAGGGGCGTGCAGCTGCTGTGTCTGATGTGGGGACAGCTCTTCTCCCAGATGTTAATAGAACAACCTGCACAACCTGGTTTTTTTTCCTTAATACAACCCTGAGCCATTTGCTGCATTTCTTTTCATATTAAATATGTGAATGACAATAAAACAATTTTGACTTGAA
>NM_176870.3
ACCACGCCGTCCGGGTGGGCCTAGCAGTCGCTCCATTTATCGCTTGAGATCTCCAGCCTTACCGCGGCTCGAAATGGACCCCAACTGCTCCTGCACCACTGGTGTCTCCTGCGCCTGCACCGGCTCCTGCACGTGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCCGTGGGCTGTGCCAAGTGTGCCCACGGCTGTGTCTGCAAAGGGACGTTGGAGAACTGCAGCTGCTGTGCCTGATGTGGGAACAGCTCTTCTCCCAGATGTTAATAGAACAAGCTGCACAACCTGGATTTTTTTTCAATACGATACTGAGCCATTTGCTGCATTTCTTTTTATATTAAATATGTGAGTGACAATAAAACAATTTTGACTTGAA

Publications

PMID - Link Title