Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name GPX1P2
Wait
Plot displaying the genomic locations of a retrocopy (in chr21) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr21:27143134-27143999  UCSC
Coordinates (T2T) chr21:25501542-25502407  UCSC
Coordinates (hg19) chr21:28515453-28516318  UCSC
Strand -
Parental Sequence NM_000581.4
Parental seq. overlap 814 bp
Parental seq. overlap (%) 89.9%
Genomic Region Intergenic
Retrocopy Summary GPX1P2, located on chr21:27143134-27143999, is a retrocopy of the parental gene GPX1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name GPX1
Full Name glutathione peroxidase 1
Also known as GPXD|GSHPX1
Coordinate chr3:49357176-49358353
Strand -
Gene summary The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. This gene contains an in-frame GCG trinucleotide repeat in the coding region, and three alleles with 4, 5 or 6 repeats have been found in the human population. The allele with 4 GCG repeats has been significantly associated with breast cancer risk in premenopausal women. Alternatively spliced transcript variants have been found for this gene. Pseudogenes of this locus have been identified on chromosomes X and 21. [provided by RefSeq, Aug 2017]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes GPX1P1
Bonobo Pan paniscus GPX1P1
Gorilla Gorilla gorilla GPX1P1
Orangutan Pongo abelii GPX1P1
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.10.20.3
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>GPX1P2
ACAGTGTTTGTTCGGGGCGCTCCCCTAGCTTCTCGGACAGTTGCGCCCTGTGTGCTGCTGGGCTAGCGGCGGCGGCTGCCCAGTCGGTGTAAGCCTTTTCCGCGCGCGCCCGCTGGCCGGCGGGGAGCCTGTGAGCCTGGGCTCCCTGCGGGGCAAGGGACTACTTATCGAGAATGTGGCGTCCCTCGGAGGCACCACGGTCCGGGACTACACCCAGATGAACGAGCCGCAGCGGCGCCTCGGCCCCGGGGCCTGGTGGTGCTTGGCTTCCCGTGCAACCAGTCTGGGCATCAGGAGAACGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCAACCTGGTGGTGGGTTCGAGCCCAGCTTCATGCTCTTGGAGAAGTGCGAGGTGAACGGTGCGGGGGCGCACCCTCTCTCCGCCTTTCTGCGGGACGCCGGCCAGCCCCCAGGGACGACGCCACTGAGCTCATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTTCTTTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCTGTATGCAGGTATAGCTGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGATGTGCCTAGGGCGCCCCTCCTACCCCGACTGCTTGGCAGTTGCAGCGCTGCTCTCTGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTGCAAGGAGGAACACCTGATCTTGCAGAAAATACCCCCTCGAGATGGGCGCTGGTCCTGTCCATCCCAGTCTCTGCCAAACCAAGGCGAGTTTCCCCACTAATAAAGTGCCGGGTGTCAGCAGAAA
>NM_000581.4
AAAAGGAGGCGCCTGCTGGCCTCCCCTTACAGTGCTTGTTCGGGGCGCTCCGCTGGCTTCTTGGACAATTGCGCCATGTGTGCTGCTCGGCTAgcggcggcggcggcggcggcCCAGTCGGTGTATGCCTTCTCGGCGCGCCCGCTGGCCGGCGGGGAGCCTGTGAGCCTGGGCTCCCTGCGGGGCAAGGTACTACTTATCGAGAATGTGGCGTCCCTCTGAGGCACCACGGTCCGGGACTACACCCAGATGAACGAGCTGCAGCGGCGCCTCGGACCCCGGGGCCTGGTGGTGCTCGGCTTCCCGTGCAACCAGTTTGGGCATCAGGAGAACGCCAAGAACGAAGAGATTCTGAATTCCCTCAAGTACGTCCGGCCTGGTGGTGGGTTCGAGCCCAACTTCATGCTCTTCGAGAAGTGCGAGGTGAACGGTGCGGGGGCGCACCCTCTCTTCGCCTTCCTGCGGGAGGCCCTGCCAGCTCCCAGCGACGACGCCACCGCGCTTATGACCGACCCCAAGCTCATCACCTGGTCTCCGGTGTGTCGCAACGATGTTGCCTGGAACTTTGAGAAGTTCCTGGTGGGCCCTGACGGTGTGCCCCTACGCAGGTACAGCCGCCGCTTCCAGACCATTGACATCGAGCCTGACATCGAAGCCCTGCTGTCTCAAGGGCCCAGCTGTGCCTAGGGCGCCCCTCCTACCCCGGCTGCTTGGCAGTTGCAGTGCTGCTGTCTCGGGGGGGTTTTCATCTATGAGGGTGTTTCCTCTAAACCTACGAGGGAGGAACACCTGATCTTACAGAAAATACCACCTCGAGATGGGTGCTGGTCCTGTTGATCCCAGTCTCTGCCAGACCAAGGCGAGTTTCCCCACTAATAAAGTGCCGGGTGTCAGCAGAA

Publications

PMID - Link Title
No publications available for this retrocopy