| Retrocopy Name | EDDM3CP |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr2:134320008-134320176 UCSC | |
| Coordinates (T2T) | chr2:134759487-134759655 UCSC | |
| Coordinates (hg19) | chr2:135077579-135077747 UCSC | |
| Strand | - | |
| Parental Sequence | NM_022360.5 | |
| Parental seq. overlap | 143 bp | |
| Parental seq. overlap (%) | 15.4% | |
| Genomic Region |
Intragenic (MGAT5) |
|
| Retrocopy Summary | EDDM3CP, located on chr2:134320008-134320176, is a retrocopy of the parental gene EDDM3B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | EDDM3B |
| Full Name | epididymal protein 3B |
| Also known as | EP3B|FAM12B|HE3-BETA|HE3B|RAM2 |
| Coordinate | chr14:20768404-20770948 |
| Strand | + |
| Gene summary | Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Bonobo | Pan paniscus | LOC100994800P1 |
![]() |
Gorilla | Gorilla gorilla | EDDM3BP1 |
![]() |
Orangutan | Pongo abelii | LOC100459946P1 |
![]() |
Green monkey | Chlorocebus sabaeus | EDDM3BP1 |
![]() |
Crab-eating macaque | Macaca fascicularis | EDDM3BP1 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | EDDM3BP1 |
![]() |
Chimpanzee | Pan troglodytes | Without Homology |
![]() |
Gibbon | Nomascus leucogenys | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >EDDM3CP |
| AGGAGGACATAGACTCTGCTATTCAGATCCACACACTGATCCCTCTACAAGCAGTGACTCAAACACTGAATCTGAATAGGGTGGCTCTGGTGACTGAGATGGCAACCTCTCTAAAGATCTGGAGCCTGCTCTTGGCCCTGCTTTGATCCTATGCAGGCTGCTTGTACAC |
| >NM_022360.5 |
| AGATTTCCAGGGCCCTGAGGAAAGGAGGACTCAGACTCTGCTCTTCAGATCCACACACTGATCCCAACTACAACCAGTGACCTGAACTTGGAGTCTGAGTAGGGCGGCCCCGGTGACTGAGATGGCATCGTCTCTAAAGATCTGGGGCACACTCTTGGCCCTACTTTGCATCCTATGCACACTGCTTGTACAGAGCAAAGAAGTTTCTTGGAGAGAATTCATGAAACAGCACTACTTAAGTCCAAGTCGAGAATTCAGAGAGTACAAATGTGATGTCCTCATGAGAGAAAATGAAGCTCTGAAAGACAAGAGCTCTCACATGTTTATCTATATCTCATGGTACAAAATCGAGCATATATGCACTAGTGACAACTGGATGGATCGCTTCCGAAATGCATATGTATGGGTCCAGAATCCTCTCAAAGTACTCAAGTGTCACCAGGAGAATTCCAAAAATAGCTACACAGAGAGCAGGAGCTTCAACTACATTGAATTCCATTGTAGCATGGACGGGTATGTTGATAGCATAGAAGACCTAAAGATGGTAGAACCTATCGGCAACTAGAAAGTCTATGCACATCCTCAGGTATTGGTAGAGTATTCAGTGCTTTCTAAGTAGCAGCCCCTGCCTCCATCAATAGTCCTACCACTCCCCTCTTGCATTTATTTGTCAATGTTTTCCAAATACTTAGAGTTATGAATAGCATAAtttcttgataccataactttgcctgtgttgtttctctgcctggaatacacttttgtcttcatttacctaatttactcttatacttttgtcgacattcagctcatatggcatctgttcttgattaacccaagactttcctgaTATTGACTCTCTTGATACATACCCAAGCTGAACAATCTTCCCTTCCCTAAATAAATTATATGACTGCAA |
| PMID - Link | Title |
|---|