Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name EDDM3CP
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:134320008-134320176  UCSC
Coordinates (T2T) chr2:134759487-134759655  UCSC
Coordinates (hg19) chr2:135077579-135077747  UCSC
Strand -
Parental Sequence NM_022360.5
Parental seq. overlap 143 bp
Parental seq. overlap (%) 15.4%
Genomic Region Intragenic (MGAT5)
Retrocopy Summary EDDM3CP, located on chr2:134320008-134320176, is a retrocopy of the parental gene EDDM3B. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name EDDM3B
Full Name epididymal protein 3B
Also known as EP3B|FAM12B|HE3-BETA|HE3B|RAM2
Coordinate chr14:20768404-20770948
Strand +
Gene summary Testicular sperm are morphologically differentiated but are not progressively motile nor able to fertilize an egg. Post-testicular maturation requires exposure of spermatozoa to the microenvironment of the epididymal lumen. Spermatozoa undergo extensive changes in the epididymis, including enzymatic modifications, loss of pre-existing components and addition of new glycoproteins from epididymal secretions. These modifying proteins and enzymes are synthesized by epithelial cells lining the epididymal duct and secreted apically into the lumen, where they come into contact with, and may be absorbed onto, the sperm membranes. The proteins encoded by the genes in this cluster are synthesized and secreted by epididymal epithelial cells. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Bonobo Pan paniscus LOC100994800P1
Gorilla Gorilla gorilla EDDM3BP1
Orangutan Pongo abelii LOC100459946P1
Green monkey Chlorocebus sabaeus EDDM3BP1
Crab-eating macaque Macaca fascicularis EDDM3BP1
Golden snub-nosed monkey Rhinopithecus roxellana EDDM3BP1
Chimpanzee Pan troglodytes Without Homology
Gibbon Nomascus leucogenys Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>EDDM3CP
AGGAGGACATAGACTCTGCTATTCAGATCCACACACTGATCCCTCTACAAGCAGTGACTCAAACACTGAATCTGAATAGGGTGGCTCTGGTGACTGAGATGGCAACCTCTCTAAAGATCTGGAGCCTGCTCTTGGCCCTGCTTTGATCCTATGCAGGCTGCTTGTACAC
>NM_022360.5
AGATTTCCAGGGCCCTGAGGAAAGGAGGACTCAGACTCTGCTCTTCAGATCCACACACTGATCCCAACTACAACCAGTGACCTGAACTTGGAGTCTGAGTAGGGCGGCCCCGGTGACTGAGATGGCATCGTCTCTAAAGATCTGGGGCACACTCTTGGCCCTACTTTGCATCCTATGCACACTGCTTGTACAGAGCAAAGAAGTTTCTTGGAGAGAATTCATGAAACAGCACTACTTAAGTCCAAGTCGAGAATTCAGAGAGTACAAATGTGATGTCCTCATGAGAGAAAATGAAGCTCTGAAAGACAAGAGCTCTCACATGTTTATCTATATCTCATGGTACAAAATCGAGCATATATGCACTAGTGACAACTGGATGGATCGCTTCCGAAATGCATATGTATGGGTCCAGAATCCTCTCAAAGTACTCAAGTGTCACCAGGAGAATTCCAAAAATAGCTACACAGAGAGCAGGAGCTTCAACTACATTGAATTCCATTGTAGCATGGACGGGTATGTTGATAGCATAGAAGACCTAAAGATGGTAGAACCTATCGGCAACTAGAAAGTCTATGCACATCCTCAGGTATTGGTAGAGTATTCAGTGCTTTCTAAGTAGCAGCCCCTGCCTCCATCAATAGTCCTACCACTCCCCTCTTGCATTTATTTGTCAATGTTTTCCAAATACTTAGAGTTATGAATAGCATAAtttcttgataccataactttgcctgtgttgtttctctgcctggaatacacttttgtcttcatttacctaatttactcttatacttttgtcgacattcagctcatatggcatctgttcttgattaacccaagactttcctgaTATTGACTCTCTTGATACATACCCAAGCTGAACAATCTTCCCTTCCCTAAATAAATTATATGACTGCAA

Publications

PMID - Link Title