Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PSMA6P3
Wait
Plot displaying the genomic locations of a retrocopy (in chr21) and its respective parental gene (in chr14). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr21:46072076-46072249  UCSC
Coordinates (T2T) chr21:44449444-44449617  UCSC
Coordinates (hg19) chr21:47491990-47492163  UCSC
Strand -
Parental Sequence NM_001282233.1
Parental seq. overlap 151 bp
Parental seq. overlap (%) 15.4%
Genomic Region Intergenic
Retrocopy Summary PSMA6P3, located on chr21:46072076-46072249, is a retrocopy of the parental gene PSMA6. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PSMA6
Full Name proteasome 20S subunit alpha 6
Also known as IOTA|PROS27|p27K
Coordinate chr14:35278558-35317493
Strand +
Gene summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PSMA6P2
Bonobo Pan paniscus PSMA6P2
Golden snub-nosed monkey Rhinopithecus roxellana PSMA6P3
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Related Sequence

>PSMA6P3
TGAACAGACAGTGGTAACTGCAATTACCTGCCTGTCTACCGTGCTATCCATTGGTTTCAAATCATCAGAAAGAAAAGTTGGAGAGATTACAGCTGCAAATCCTAAATTCAGGATACTTACAGAAGCAGAGGCTGACGCTCACCTTGTCATTCTAGCAGAAACTAAACATTGTCA
>NM_001282233.1
GCTCGAACTGGCTCCAGAGCCGTGAGTTCGGCATGCAAGAGCGGAAGAAACGCGGCTGGTACCCCGGAAGCAGTCGCTGCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGCGCCGGTTTTGACCGCCACATTACCATTTTTTCACCCGAGGGTCGGCTCTACCAAGTAGGACAAATTATTGGATTCCAGCACAGTGACTCACTTATTCAAGATAACTGAAAACATTGGTTGTGTGATGACCGGAATGACAGCTGACAGCAGATCCCAGGTACAGAGGGCACGCTATGAGGCAGCTAACTGGAAATACAAGTATGGCTATGAGATTCCTGTGGACATGCTGTGTAAAAGAATTGCCGATATTTCTCAGGTCTACACACAGAATGCTGAAATGAGGCCTCTTGGTTGTTGTATGATTTTAATTGGTATAGATGAAGAGCAAGGCCCTCAGGTATATAAGTGTGATCCTGCAGGTTACTACTGTGGGTTTAAAGCCACTGCAGCGGGAGTTAAACAAACTGAGTCAACCAGCTTCCTTGAAAAAAAAGTGAAGAAGAAATTTGATTGGACATTTGAACAGACAGTGGAAACTGCAATTACATGCCTGTCTACTGTTCTATCAATTGATTTCAAACCTTCAGAAATAGAAGTTGGAGTAGTGACAGTTGAAAATCCTAAATTCAGGATTCTTACAGAAGCAGAGATTGATGCTCACCTTGTTGCTCTAGCAGAGAGAGACTAAACATTGTCGTTAGTTTACCAGATCCGTGATGCCACTTACCTGTGTGTTTGGTAACAACAAACCAACATCATGGAGGTCCCTGGATTGAAAAAGGAGCCTCTCCCACTCCTCCTACCACCGAAGTGGTTAGGACTCTATATAAATAAAAACAAGGCTTTTGGAAAATAATTGCA

Publications

PMID - Link Title
No publications available for this retrocopy