Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPL17P12
Wait
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr18). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:146194275-146194542  UCSC
Coordinates (T2T) chr2:146642980-146643247  UCSC
Coordinates (hg19) chr2:146951843-146952110  UCSC
Strand +
Parental Sequence NM_001035006.5
Parental seq. overlap 235 bp
Parental seq. overlap (%) 38.2%
Genomic Region Intergenic
Retrocopy Summary RPL17P12, located on chr2:146194275-146194542, is a retrocopy of the parental gene RPL17-C18orf32. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPL17-C18orf32
Full Name RPL17-C18orf32 readthrough
Also known as PD-1|RPL17
Coordinate chr18:49481178-49492465
Strand -
Gene summary This locus represents naturally occurring read-through transcription between the neighboring RPL17 (ribosomal protein L17) and C18orf32 (chromosome 18 open reading frame 32) genes. Alternative splicing results in multiple transcript variants. The encoded isoforms share sequence identity with the RPL17 protein, but they include frameshifted C-terminal regions derived from the downstream gene exons. [provided by RefSeq, Dec 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPL17P7
Bonobo Pan paniscus RPL17P9
Gorilla Gorilla gorilla RPL17P7
Orangutan Pongo abelii LOC103892985P6
Gibbon Nomascus leucogenys RPL17P47
Green monkey Chlorocebus sabaeus RPL17P22
Crab-eating macaque Macaca fascicularis LOC101867070P41
Rhesus Macaca mulatta RPL17P40
Baboon Papio anubis RPL17P36
Golden snub-nosed monkey Rhinopithecus roxellana RPL17P40
Marmoset Callithrix jacchus LOC100411528P1
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.050.10.150.2
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>RPL17P12
GGCCTGAGGTGATATTTGAAAATGGTTCACTATTCGATTGACACAGAAAACCCCACAAAGTCATGCAAATCAAGAGATTCAAATCGTATTCATTTAAGAACACTCGTGAAACTGCCCAGGCCATCAAGGATATGCATGTATGAAAAGCCACTAAGTGACCTGAAAGATGTCACTTTACAGAAACAGCATGTACCATTCCAACATTACAATGGTGGAGTTGGTAGGTGTGCCCAGGCCAAACAGTGGAGCTGGACATAGGATCGGTGGC
>NM_001035006.5
AGCCTGAGGTGATCTGTGAAAATGGTTCGCTATTCACTTGACCCGGAGAACCCCACGAAATCATGCAAATCAAGAGGTTCCAATCTTCGTGTTCACTTTAAGAACACTCGTGAAACTGCTCAGGCCATCAAGGGTATGCATATACGAAAAGCCACGAAGTATCTGAAAGATGTCACTTTACAGAAACAGTGTGTACCATTCCGACGTTACAATGGTGGAGTTGGCAGGTGTGCGCAGGCCAAGCAATGGGGCTGGACACAAGGTCGGTGGCCCAAAAAGAGTGCTGAATTTTTGCTGCACATGCTTAAAAACGCAGAGAGTAATGCTGAACTTAAGGGTTTAGATGTAGATTCTCTGGTCATTGAGCATATCCAAGTGAACAAAGCACCTAAGATGCGCCGCCGGACCTACAGAGCTCATGGTCGGATTAACCCATACATGAGCTCTCCCTGCCACATTGAGATGATCCTTACGGAAAAGGAACAGATTGTTCCTAAACCAGAAGAGGAGGTTGCCCAGAAGAAAAAGATATCCCAGAAGAAACTGAAGAAACAAAAACTTATGGCACGGGAGTAAATTCAGCATTAAAATAAATGTAATTAAAAGGAAAAGAA

Publications

PMID - Link Title
19123937Comparative analysis of processed ribosomal protein pseudogenes in four mammalian genomes.