Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name TXNP8
Wait
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr9). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:169766000-169766159  UCSC
Coordinates (T2T) chr2:170246000-170246159  UCSC
Coordinates (hg19) chr2:170622510-170622669  UCSC
Strand -
Parental Sequence NM_001244938.2
Parental seq. overlap 140 bp
Parental seq. overlap (%) 20.7%
Genomic Region Intergenic
Retrocopy Summary TXNP8, located on chr2:169766000-169766159, is a retrocopy of the parental gene TXN. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name TXN
Full Name thioredoxin
Also known as TRDX|TRX|TRX1|Trx80
Coordinate chr9:110243810-110256507
Strand -
Gene summary The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes TXNP4
Bonobo Pan paniscus TXNP4
Gorilla Gorilla gorilla TXNP4
Gibbon Nomascus leucogenys TXNP9
Green monkey Chlorocebus sabaeus TXNP5
Crab-eating macaque Macaca fascicularis TXNP8
Rhesus Macaca mulatta TXNP10
Baboon Papio anubis TXNP8
Golden snub-nosed monkey Rhinopithecus roxellana TXNP9
Orangutan Pongo abelii Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the GTEx database for expression quantification.

This retrocopy transcript is not present in the ARCHS4 database for expression quantification

Related Sequence

>TXNP8
AACCTTACAATTTTTTAAAAAGAGACAAAATGTGGTTGAATTATCTGGAGCTAATAAGAAAAAACTTGAAGCAACCATTAATCAATCTAATCATGTTCTCTGAAAATATAACCAGCCATTGGCTATTTAAAACTTGTAATTTTTTTTATTTACAAT
>NM_001244938.2
GAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGACTCCAGCAGCCAAGATGGTGAAGCAGATCGAGAGCAAGACTGCTTTTCAGGAAGCCTTGGACGCTGCAGGTGATAAACTTGTAGTAGTTGACTTCTCAGCCACGTGGTGTGGGCCTTGCAAAATGATCAAGCCTTTCTTTCATGATGTTGCTTCAGAGTGTGAAGTCAAATGCATGCCAACATTCCAGTTTTTTAAGAAGGGACAAAAGGTGGGTGAATTTTCTGGAGCCAATAAGGAAAAGCTTGAAGCCACCATTAATGAATTAGTCTAATCATGTTTTCTGAAAATATAACCAGCCATTGGCTATTTAAAACTTGTAATTTTTTTAATTTACAAAAATATAAAATATGAAGACATAAACCCAGTTGCCATCTGCGTGACAATAAAACATTAATGCTAACACTTTTTAAAACCGTCTCATGTCTGAATAGCTTTCAAAATAAATGTGAAATGGTCATTTAATGTATTTTCCTATATTCTCAATCACTTTTTAGTAACCTTGTAGGCCACTGATTATTTTAAGATTTTAAAAATTATTATTGCTACCTTAATGTATTGCTACAAAAATCTCTTGTTGGGGGCAATGCAGGTAATAAAGTAGTATGTTGTTATTTGTTA

Publications

PMID - Link Title
No publications available for this retrocopy