| Retrocopy Name | TXNP8 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr2:169766000-169766159 UCSC | |
| Coordinates (T2T) | chr2:170246000-170246159 UCSC | |
| Coordinates (hg19) | chr2:170622510-170622669 UCSC | |
| Strand | - | |
| Parental Sequence | NM_001244938.2 | |
| Parental seq. overlap | 140 bp | |
| Parental seq. overlap (%) | 20.7% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | TXNP8, located on chr2:169766000-169766159, is a retrocopy of the parental gene TXN. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | TXN |
| Full Name | thioredoxin |
| Also known as | TRDX|TRX|TRX1|Trx80 |
| Coordinate | chr9:110243810-110256507 |
| Strand | - |
| Gene summary | The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | TXNP4 |
![]() |
Bonobo | Pan paniscus | TXNP4 |
![]() |
Gorilla | Gorilla gorilla | TXNP4 |
![]() |
Gibbon | Nomascus leucogenys | TXNP9 |
![]() |
Green monkey | Chlorocebus sabaeus | TXNP5 |
![]() |
Crab-eating macaque | Macaca fascicularis | TXNP8 |
![]() |
Rhesus | Macaca mulatta | TXNP10 |
![]() |
Baboon | Papio anubis | TXNP8 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | TXNP9 |
![]() |
Orangutan | Pongo abelii | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >TXNP8 |
| AACCTTACAATTTTTTAAAAAGAGACAAAATGTGGTTGAATTATCTGGAGCTAATAAGAAAAAACTTGAAGCAACCATTAATCAATCTAATCATGTTCTCTGAAAATATAACCAGCCATTGGCTATTTAAAACTTGTAATTTTTTTTATTTACAAT |
| >NM_001244938.2 |
| GAAGCTCTGTTTGGTGCTTTGGATCCATTTCCATCGGTCCTTACAGCCGCTCGTCAGACTCCAGCAGCCAAGATGGTGAAGCAGATCGAGAGCAAGACTGCTTTTCAGGAAGCCTTGGACGCTGCAGGTGATAAACTTGTAGTAGTTGACTTCTCAGCCACGTGGTGTGGGCCTTGCAAAATGATCAAGCCTTTCTTTCATGATGTTGCTTCAGAGTGTGAAGTCAAATGCATGCCAACATTCCAGTTTTTTAAGAAGGGACAAAAGGTGGGTGAATTTTCTGGAGCCAATAAGGAAAAGCTTGAAGCCACCATTAATGAATTAGTCTAATCATGTTTTCTGAAAATATAACCAGCCATTGGCTATTTAAAACTTGTAATTTTTTTAATTTACAAAAATATAAAATATGAAGACATAAACCCAGTTGCCATCTGCGTGACAATAAAACATTAATGCTAACACTTTTTAAAACCGTCTCATGTCTGAATAGCTTTCAAAATAAATGTGAAATGGTCATTTAATGTATTTTCCTATATTCTCAATCACTTTTTAGTAACCTTGTAGGCCACTGATTATTTTAAGATTTTAAAAATTATTATTGCTACCTTAATGTATTGCTACAAAAATCTCTTGTTGGGGGCAATGCAGGTAATAAAGTAGTATGTTGTTATTTGTTA |
| PMID - Link | Title |
|---|