Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NACAP11
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr12). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:17514776-17515008  UCSC
Coordinates (T2T) chr2:17546538-17546770  UCSC
Coordinates (hg19) chr2:17696043-17696275  UCSC
Strand +
Parental Sequence NM_001320193.2
Parental seq. overlap 198 bp
Parental seq. overlap (%) 23.7%
Genomic Region Intragenic (RAD51AP2)
Retrocopy Summary NACAP11, located on chr2:17514776-17515008, is a retrocopy of the parental gene NACA. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NACA
Full Name nascent polypeptide associated complex subunit alpha
Also known as HSD48|NAC-alpha|NACA1|skNAC
Coordinate chr12:56712427-56725299
Strand -
Gene summary This gene encodes a protein that associates with basic transcription factor 3 (BTF3) to form the nascent polypeptide-associated complex (NAC). This complex binds to nascent proteins that lack a signal peptide motif as they emerge from the ribosome, blocking interaction with the signal recognition particle (SRP) and preventing mistranslocation to the endoplasmic reticulum. This protein is an IgE autoantigen in atopic dermatitis patients. Alternative splicing results in multiple transcript variants, but the full length nature of some of these variants, including those encoding very large proteins, has not been determined. There are multiple pseudogenes of this gene on different chromosomes. [provided by RefSeq, Feb 2016]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NACAP1
Bonobo Pan paniscus NACAP1
Gorilla Gorilla gorilla NACAP1
Orangutan Pongo abelii NACAP1
Gibbon Nomascus leucogenys NACAP7
Green monkey Chlorocebus sabaeus LOC103238540P7
Crab-eating macaque Macaca fascicularis NACAP9
Rhesus Macaca mulatta NACAP9
Baboon Papio anubis LOC101018001P9
Golden snub-nosed monkey Rhinopithecus roxellana NACAP10
Marmoset Callithrix jacchus NACAP9
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NACAP11
GTTAAGGACATAGAATTGGTCATGCCAGAAGCAAATGTGTCGAGAGCAAAGGCAGTCTGAGCCCTGAAGTACAAGTAATGATATGTGGTAAATGCTATTGTGGAATTAACAATGTAACTGTATGAAAACACCTTTTTTTTTTTTCTTGGTGTTTCCAAGGAGTAACTGCAGCTTGCTTTGAAATTTGTATTGTTTCTATCATAAATAAAGCTATGGCTTCTTGCTGG
>NM_001320193.2
CTTTCTGCCGCCATCTTGGTTCCGCGTTCCCTGCACAGCCTCCTTTTTATTCCCTTCCTTCAGAAATGCCCGGCGAAGCCACAGAAACCGTCCCTGCTACAGAGCAGGAGTTGCCGCAGCCCCAGGCTGAGACAGGGTCTGGAACAGAATCTGACAGTGATGAATCAGTACCAGAGCTTGAAGAACAGGATTCCACCCAGGCAACCACACAACAAGCCCAGCTGGCGGCAGCAGCTGAAATTGATGAAGAACCAGTCAGTAAAGCAAAACAGAGTCGGAGTGAAAAGAAGGCACGGAAGGCTATGTCCAAACTGGGTCTTCGGCAGGTTACAGGAGTTACTAGAGTCACTATCCGGAAATCTAAGAATATCCTCTTTGTCATCACAAAACCAGATGTCTACAAGAGCCCTGCTTCAGATACTTACATAGTTTTTGGGGAAGCCAAGATCGAAGATTTATCCCAGCAAGCACAACTAGCAGCTGCTGAGAAATTCAAAGTTCAAGGTGAAGCTGTCTCAAACATTCAAGAAAACACACAGACTCCAACTGTACAAGAGGAGAGTGAAGAGGAAGAGGTCGATGAAACAGGTGTAGAAGTTAAGGACATTGAATTGGTCATGTCACAAGCAAATGTGTCGAGAGCAAAGGCAGTCCGAGCCCTGAAGAACAACAGTAATGATATTGTAAATGCGATTATGGAATTAACAATGTAACCATATGGAAGCAACTTTTTTTGGTGTCTCAAAGGAGTAACTGCAGCTTGGTTTGAAATTTGTACTGTTTCTATCATAAATAAAGTTATGGCTTCTTGTTGGATGAATTCA

Publications

PMID - Link Title