Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PRDX5P1
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:178105634-178105808  UCSC
Coordinates (T2T) chr2:178588392-178588566  UCSC
Coordinates (hg19) chr2:178970361-178970535  UCSC
Strand +
Parental Sequence NM_001358511.2
Parental seq. overlap 165 bp
Parental seq. overlap (%) 22.8%
Genomic Region Intragenic (PDE11A)
Retrocopy Summary PRDX5P1, located on chr2:178105634-178105808, is a retrocopy of the parental gene PRDX5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PRDX5
Full Name peroxiredoxin 5
Also known as ACR1|AOEB166|B166|HEL-S-55|PLP|PMP20|PRDX6|PRXV|SBBI10|prx-V
Coordinate chr11:64318121-64321811
Strand +
Gene summary This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein interacts with peroxisome receptor 1 and plays an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. The use of alternate transcription start sites is thought to result in transcript variants that use different in-frame translational start codons to generate isoforms that are targeted to the mitochondrion (isoform L) or peroxisome/cytoplasm (isoform S). Multiple related pseudogenes have been defined for this gene. [provided by RefSeq, Nov 2017]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PRDX5P1
Bonobo Pan paniscus PRDX5P1
Gorilla Gorilla gorilla PRDX5P1
Orangutan Pongo abelii PRDX5P1
Green monkey Chlorocebus sabaeus PRDX5P1
Rhesus Macaca mulatta PRDX5P2
Baboon Papio anubis PRDX5P2
Gibbon Nomascus leucogenys Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>PRDX5P1
TATCGATGTCTCAGGAGGTTCTCCATGGTGGTACAGGATGGCATAATGAAGGCCCTGAATGTGGAACCTGATGGCATAGGTCTCACCTGCAGCCTGGCACCCAATATCACCTCACAGCTCTGAGCCCCTGGGCCAGATCACTTCCTCCACCCCTCCCTATCTCACCTGCCCAGCC
>NM_001358511.2
CTTCCGCAGGGTGTCGCCGCTGTGCCGCTAGCGGTGCCCCGCCTGCTGCGGTGGCACCAGCCAGGAGGCGGAGTGGAAGTGGCCGTGGGGCGGGTATGGGACTAGCTGGCGTGTGCGCCCTGAGACGCTCAGCGGGCTATATACTCGTCGGTGGGGCCGGCGGTCAGTCTGCGGCAGCGGCAGCAAGACGGTACAGTGAAGGAGAGTGGGCGTCTGGCGGGGTCCGCAGTTTCAGCAGAGCCGCTGCAGCCATGGCCCCAATCAAGACACACCTGCCAGGGTTTGTGGAGCAGGCTGAGGCTCTGAAGGCCAAGGGAGTCCAGGTGGTGGCCTGTCTGAGTGTTAATGATGCCTTTGTGACTGGCGAGTGGGGCCGAGCCCACAAGGCGGAAGGCAAGGTTCGGCTCCTGGCTGATCCCACTGGGGCCTTTGGGAAGGAGACAGACTTATTACTAGATGATTCGCTGGTGTCCATCTTTGGGAATCGACGTCTCAAGAGGTTCTCCATGGTGGTacaggatggcatagtgaaggccctgaatgtggaaccagatggcacaggcctcacctgcagcctggcacccaatatcatctcacagctctgaggccctgggccagattacttcctccacccctccctatctcaCCTGCCCAGCCCTGTGCTGGGGCCCTGCAATTGGAATGTTGGCCAGATTTCTGCAATAAACACTTGTGGTTTGCGGCCA

Publications

PMID - Link Title