Retrocopy Name | DPRXP1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr2:186488871-186489078 UCSC | |
Coordinates (T2T) | chr2:186978161-186978368 UCSC | |
Coordinates (hg19) | chr2:187353598-187353805 UCSC | |
Strand | - | |
Parental Sequence | NM_001012728.1 | |
Parental seq. overlap | 179 bp | |
Parental seq. overlap (%) | 27.6% | |
Genomic Region |
Intragenic (ZC3H15) |
|
Retrocopy Summary | DPRXP1, located on chr2:186488871-186489078, is a retrocopy of the parental gene DPRX. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | DPRX |
Full Name | divergent-paired related homeobox |
Also known as | - |
Coordinate | chr19:53601114-53637057 |
Strand | + |
Gene summary | Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the DPRX homeobox gene family. Evidence of mRNA expression has not yet been found for this gene. Multiple, related processed pseudogenes have been found which are thought to reflect expression of this gene in the germ line or embryonic cells. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | DPRXP1 |
![]() |
Bonobo | Pan paniscus | DPRXP1 |
![]() |
Gorilla | Gorilla gorilla | DPRXP1 |
![]() |
Orangutan | Pongo abelii | DPRXP1 |
![]() |
Gibbon | Nomascus leucogenys | DPRXP2 |
![]() |
Green monkey | Chlorocebus sabaeus | DPRXP3 |
![]() |
Crab-eating macaque | Macaca fascicularis | DPRXP3 |
![]() |
Rhesus | Macaca mulatta | DPRXP3 |
![]() |
Baboon | Papio anubis | DPRXP2 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | DPRXP5 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>DPRXP1 |
AGGAAACAAACTATGATCACTGAGAAACAAATGGAATATTTGAACATCTTGTTCACTAAGAACCCATACCCAAACCTCAGTCTTCAGAAAGAAATGGCCTCAAAGACATACATCCAACGGTACTGCAGGTTAGGTTAAAGAATGATAGCACAAAACACAAGAAAGCAAAATGCAAGCATATTCAGCAAAAGCAAGAAGCTCAACAACT |
>NM_001012728.1 |
TGCTAGTTCTTATCCCTGGACCTGAACCCAGGCGCACATCTGGATTAGAAGATGCCAGGCTCAGAGGATCTTCGTAAAGGCAAGGACCAGATGCATTCACACAGGAAACGAACCATGTTCACTAAGAAGCAACTGGAAGATCTGAACATCTTGTTCAATGAGAACCCATACCCAAACCCCAGCCTTCAGAAAGAAATGGCCTCGAAAATAGACATACACCCAACAGTACTGCAGGTCTGGTTCAAGAATCACAGAGCAAAACTCAAGAAAGCGAAATGCAAGCATATTCATCAAAAACAAGAAACTCCACAACCGCCAATACCAGAGGGTGGGGTCTCCACCAGTGTCGGCCTGAGAAATGCAGACACACTACCCAGATTGCCCAACGCTGCTCACCCGATCGGCCTGGTGTACACGGGTCATCGAGTCCCCTCATTCCAGCTCATCCTGTACCCCAACCTCAAGGTCCCTGCAAATGACTTCATTGGCCACAGAATAGTCCATTTTGGCTGCTGCCGAGATCCTAATATATACTGCCTCTACCCCATTTTGGAATCCCAAGTTTGCGCTCCAAGCTTCCATTCTGGCTCTCCTGCCTGTTCATCTAACCAAAGTCGAGAGAGATGATAAATACAAAAAGTCACATGT |
PMID - Link | Title |
---|