Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name DPRXP1
Plot displaying the genomic locations of a retrocopy (in chr2) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr2:186488871-186489078  UCSC
Coordinates (T2T) chr2:186978161-186978368  UCSC
Coordinates (hg19) chr2:187353598-187353805  UCSC
Strand -
Parental Sequence NM_001012728.1
Parental seq. overlap 179 bp
Parental seq. overlap (%) 27.6%
Genomic Region Intragenic (ZC3H15)
Retrocopy Summary DPRXP1, located on chr2:186488871-186489078, is a retrocopy of the parental gene DPRX. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name DPRX
Full Name divergent-paired related homeobox
Also known as -
Coordinate chr19:53601114-53637057
Strand +
Gene summary Homeobox genes encode DNA-binding proteins, many of which are thought to be involved in early embryonic development. Homeobox genes encode a DNA-binding domain of 60 to 63 amino acids referred to as the homeodomain. This gene is a member of the DPRX homeobox gene family. Evidence of mRNA expression has not yet been found for this gene. Multiple, related processed pseudogenes have been found which are thought to reflect expression of this gene in the germ line or embryonic cells. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes DPRXP1
Bonobo Pan paniscus DPRXP1
Gorilla Gorilla gorilla DPRXP1
Orangutan Pongo abelii DPRXP1
Gibbon Nomascus leucogenys DPRXP2
Green monkey Chlorocebus sabaeus DPRXP3
Crab-eating macaque Macaca fascicularis DPRXP3
Rhesus Macaca mulatta DPRXP3
Baboon Papio anubis DPRXP2
Golden snub-nosed monkey Rhinopithecus roxellana DPRXP5
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>DPRXP1
AGGAAACAAACTATGATCACTGAGAAACAAATGGAATATTTGAACATCTTGTTCACTAAGAACCCATACCCAAACCTCAGTCTTCAGAAAGAAATGGCCTCAAAGACATACATCCAACGGTACTGCAGGTTAGGTTAAAGAATGATAGCACAAAACACAAGAAAGCAAAATGCAAGCATATTCAGCAAAAGCAAGAAGCTCAACAACT
>NM_001012728.1
TGCTAGTTCTTATCCCTGGACCTGAACCCAGGCGCACATCTGGATTAGAAGATGCCAGGCTCAGAGGATCTTCGTAAAGGCAAGGACCAGATGCATTCACACAGGAAACGAACCATGTTCACTAAGAAGCAACTGGAAGATCTGAACATCTTGTTCAATGAGAACCCATACCCAAACCCCAGCCTTCAGAAAGAAATGGCCTCGAAAATAGACATACACCCAACAGTACTGCAGGTCTGGTTCAAGAATCACAGAGCAAAACTCAAGAAAGCGAAATGCAAGCATATTCATCAAAAACAAGAAACTCCACAACCGCCAATACCAGAGGGTGGGGTCTCCACCAGTGTCGGCCTGAGAAATGCAGACACACTACCCAGATTGCCCAACGCTGCTCACCCGATCGGCCTGGTGTACACGGGTCATCGAGTCCCCTCATTCCAGCTCATCCTGTACCCCAACCTCAAGGTCCCTGCAAATGACTTCATTGGCCACAGAATAGTCCATTTTGGCTGCTGCCGAGATCCTAATATATACTGCCTCTACCCCATTTTGGAATCCCAAGTTTGCGCTCCAAGCTTCCATTCTGGCTCTCCTGCCTGTTCATCTAACCAAAGTCGAGAGAGATGATAAATACAAAAAGTCACATGT

Publications

PMID - Link Title