| Retrocopy Name | RPL36P32 | 
                 | 
        
| Species | Homo sapiens | |
| Coordinates (hg38) | chr22:30105088-30105424 UCSC | |
| Coordinates (T2T) | chr22:30568438-30568774 UCSC | |
| Coordinates (hg19) | chr22:30501077-30501413 UCSC | |
| Strand | - | |
| Parental Sequence | NM_033643.3 | |
| Parental seq. overlap | 285 bp | |
| Parental seq. overlap (%) | 47% | |
| Genomic Region | 
									Intragenic (HORMAD2) | 
        |
| Retrocopy Summary | RPL36P32, located on chr22:30105088-30105424, is a retrocopy of the parental gene RPL36. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. | 
| Gene Name | RPL36 | 
| Full Name | ribosomal protein L36 | 
| Also known as | L36 | 
| Coordinate | chr19:5690295-5691875 | 
| Strand | + | 
| Gene summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L36E family of ribosomal proteins. It is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] | 
| Species | Scientific Name | Retrocopy | |
![]()  | 
			Chimpanzee | Pan troglodytes | RPL36P17 | 
![]()  | 
			Bonobo | Pan paniscus | RPL36P17 | 
![]()  | 
			Orangutan | Pongo abelii | RPL36P14 | 
![]()  | 
			Gibbon | Nomascus leucogenys | RPL36P5 | 
![]()  | 
			Green monkey | Chlorocebus sabaeus | RPL36P8 | 
![]()  | 
			Crab-eating macaque | Macaca fascicularis | RPL36P14 | 
![]()  | 
			Rhesus | Macaca mulatta | RPL36P15 | 
![]()  | 
			Baboon | Papio anubis | RPL36P12 | 
![]()  | 
			Golden snub-nosed monkey | Rhinopithecus roxellana | RPL36P17 | 
![]()  | 
			Gorilla | Gorilla gorilla | Without Homology | 
![]()  | 
			Marmoset | Callithrix jacchus | Without Homology | 
![]()  | 
			Mouse lemur | Microcebus murinus | Without Homology | 
![]()  | 
			Mouse | Mus musculus | Without Homology | 
![]()  | 
			Rat | Rattus norvegicus | Without Homology | 
![]()  | 
			Chinese hamster | Cricetulus griseus | Without Homology | 
![]()  | 
			Rabbit | Oryctolagus cuniculus | Without Homology | 
![]()  | 
			Pig | Sus scrofa | Without Homology | 
![]()  | 
			Cow | Bos taurus | Without Homology | 
![]()  | 
			Sheep | Ovis aries | Without Homology | 
![]()  | 
			Dolphin | Tursiops truncatus | Without Homology | 
![]()  | 
			Horse | Equus caballus | Without Homology | 
![]()  | 
			Dog | Canis familiaris | Without Homology | 
![]()  | 
			Panda | Ailuropoda melanoleuca | Without Homology | 
![]()  | 
			Cat | Felis catus | Without Homology | 
![]()  | 
			Pale spear-nosed bat | Phyllostomus discolor | Without Homology | 
![]()  | 
			Velvety free-tailed bat | Molossus molossus | Without Homology | 
![]()  | 
			Greater mouse-eared bat | Myotis myotis | Without Homology | 
![]()  | 
			Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology | 
![]()  | 
			Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology | 
![]()  | 
			Egyptian rousette | Rousettus aegyptiacus | Without Homology | 
![]()  | 
			Sloth | Choloepus didactylus | Without Homology | 
![]()  | 
			Tasmanian Devil | Sarcophilus harrisii | Without Homology | 
![]()  | 
			Opossum | Monodelphis domestica | Without Homology | 
![]()  | 
			Platypus | Ornithorhynchus anatinus | Without Homology | 
![]()  | 
			Chicken | Gallus gallus | Without Homology | 
![]()  | 
			Turkey | Meleagris gallopavo | Without Homology | 
![]()  | 
			Zebra Finch | Taeniopygia guttata | Without Homology | 
![]()  | 
			Budgerigar | Melopsittacus undulatus | Without Homology | 
![]()  | 
			Painted Turtle | Chrysemys picta | Without Homology | 
![]()  | 
			Lizard | Anolis Carolinensis | Without Homology | 
![]()  | 
			Frog | Xenopus tropicalis | Without Homology | 
![]()  | 
			Zebrafish | Danio rerio | Without Homology | 
![]()  | 
			Drosophila | Drosophila melanogaster | Without Homology | 
| >RPL36P32 | 
| CTGGAGAGCAGCAGCCATGGTTCTGCTTTATCCTACAGCCATGGGCCTCAACAAGGGCCACAAGGTGACCAAGAATGTGAGCAAGCCCAGGCCCAGCTGCCATCGCAGGTGCCTGACCAAACACACCAAGTTCATGCGGGATATGATCTGAGAGGTGTGTGGCTTCACCCTGTATGGGCAGCATCCCATGGAGTAGCTCAAGGTCTCCAAGGACAAAAGGGCCTTCAAGTTCATCAAGAAAAAGGTGGGAACACACATCCGCACCAAGAGGAAGTAGGAGGAGCTGCGCAATGTCCTGGCCACCATGAGGAAAGCCGCTGCCAAGGACTGAGCCCCC | 
| >NM_033643.3 | 
| CCTTCCGCCACGGCCGTCTCTGGAGAGCAGCAGCCATGGCCCTACGCTACCCTATGGCCGTGGGCCTCAACAAGGGCCACAAAGTGACCAAGAACGTGAGCAAGCCCAGGCACAGCCGACGCCGCGGGCGTCTGACCAAACACACCAAGTTCGTGCGGGACATGATTCGGGAGGTGTGTGGCTTTGCCCCGTACGAGCGGCGCGCCATGGAGTTACTGAAGGTCTCCAAGGACAAACGGGCCCTCAAATTTATCAAGAAAAGGGTGGGGACGCACATCCGCGCCAAGAGGAAGCGGGAGGAGCTGAGCAACGTACTGGCCGCCATGAGGAAAGCTGCTGCCAAGAAAGACTGAGCCCCTCCCCTGCCCTCTCCCTGAAATAAAGAACAGCTTGACAGAAGCCCTGGCTCTCCTGCTGTCCGTGGGTGGGTGTGGGTGTGTCGGGGGCCCGCAGTCCCCTGTCTGGTGCCCGCTCTGAGCCACACCCTCTCCGGGTGCTGCCTGGTCGTGAATCAAAAGCCGTGGCCCGCCCACCCTTCCCGGGGCAGCAGGTGAGGAAGCCGCCGTACTGCAAATGACTTTAATCATTAAATAGCTTCTATGCCACA | 
| PMID - Link | Title | 
|---|